Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig180
Length(NT) : 1164
Best Gene Model Blast : Link to GSTUMT00004837001 E-value : 0.0
Numbers of ESTs : 20

Blast Results:

Nr Definition: sporulation protein SPS19
Accession: ref|XP_001526807.1| Score: 819 E_value: 2e-85
KEGG Definition: hypothetical protein
Accession: yli:YALI0E14322g Score: 790 E_value: 2e-82
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0725 Score: 399 E_value: 2e-39
PFAM Definition: adh_short, short chain dehydrogenase. This family contains a wide variety of dehydrogenases..
Pfam Number: pfam00106 Score: 193 E_value: 2e-15
Swissprot: P32573|SPS19_YEAST
Gene Ontology:
GO:0005782 = Cellular component: peroxisomal matrix
GO:0008670 = Molecular function: 2,4-dienoyl-CoA reductase (NADPH) activity
GO:0009062 = Biological process: fatty acid catabolic process
GO:0030437 = Biological process: ascospore formation

Sequence:
>Contig180
TTGGTTCAAACCTCACCGCACCAAAACGCGACTGCAGCCCCCTCGCTCGG
AGCCTTCGATACCTTGCACTACGAACTGGAATGTCTGCTGCGATCAAGAA
ACACATGTCCCCGATATGGGCGCCAGGGATCTTCGAAGGCAAAGTGGTCC
TCTGCACCGGTGGAGCCGGCTCAATTTGCTCTACGCAAGTAGCAGCACTA
ATCCTACTCGGCGCGAACGCCAGCATCATCGGACGGAGGAAGGACGTGAC
GGAAGCCAAAGCCGCAGAACTCCAAACACTCCGAAGCGGTAGCAAAGTCC
TCGGTATATCCACCGACGTGCGGGACTACTCGGCACTCGTCACGACGGTG
AAGCGGACGGTTGAGGAATTGGGGAGGTTGGACTATGTCATCTGTGGAGC
AGCCGGCAATTTCCTGGCAACGGTTGACAACCTATCCGTCAACGCGTTCA
AGTCTGTTATCGACATCGACGTTCTGGGTTCGTACAATACGGTGAAGGCA
TCACTGGAGGAACTCAAGAAGACCCGCGGCAAGATCATATTCGTCTCGGC
CACGCTGCATTATACCGGTTCGCCGTTCCAGGCTCATGTTTCTGCGGCGA
AGGCCGCCATAGACGCACTCTCGCGCGTGCTGTGCGTGGAGTTGGGACCT
TATGGGATTACTAGCAATTGCATAGCTCCAGGCCCCATAGCCGGCACGGA
AGGCATGGCCAGACTGTCTCGTCCAGAAGTCGCTAGTGGGGCGGAAAGGG
CAATTCCTATCCAGCGGTTGGGCCATGTTCACGAGATTGCCGATGCCACG
ATCTACCTATTGTCGCCGGCGGGAGACTACGTTAGTGGCGATGTGATTGT
TGTTGACGGCGGGGCGTGGCATAGGCAGGGCGCCTCCGCATTCCCGTACC
CGGAGTCTGTCACGAGGAAGGGCGTTGTGGAAGGCGTTAAGGGGGCGAAG
AAGGCGAAGGATAGCAAATTGTAGTTCCGAAAGGTGCCGGGTTGTAATGT
TTCTTCCACTTTATGGCGCCCCGCTCCCCTTTTCTTTGCTTTACCCCCCT
ATTTTTACACGTGACACTATGATACTTCTATCCTAAGCTTGCTGTGTACT
CGTACAAGCTACTGATACCAACATCTCACAGCACAACCCCCATCGGCATT
GTGAGCAATGTGTT

Sequences in the Contig:

SY0AAA16YJ09FM1 SY0AAA53YP11FM1 SY0AAB31YD19FM1
SY0AAB35YL13FM1 SY0AAB4YM13FM1 SY0AAB7YG20FM1
SY0AAC1YP23FM1 SY0AAC27YC23FM1 SY0AAC31YA04FM1
SY0AAC31YA04RM1 SY0AAC39YE01FM1 SY0AAC46YH02FM1
SY0AAC50YA07FM1 SY0AAD18YN16FM1 SY0AAD32YA02FM1
SY0AAD40YP19FM1 SY0AAD49YG08FM1 SY0AAD50YB21FM1
SY0AAD51YE01FM1 SY0AAD51YN08FM1