Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig18
Length(NT) : 1211
Best Gene Model Blast : Link to GSTUMT00001324001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57576.1| Score: 520 E_value: 8e-51
KEGG Definition: predicted hydrolase related to dienelactone hydrolase
Accession: aor:AO090003000393 Score: 520 E_value: 4e-51
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3043 Score: 363 E_value: 3e-35
PFAM Definition: DLH, Dienelactone hydrolase family..
Pfam Number: pfam01738 Score: 196 E_value: 6e-16
Swissprot: P39721|YAE9_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0042802 = Molecular function: identical protein binding

Sequence:
>Contig18
TTGGCCACAATCCCCATTGCATCTCAAAGTACGAGTAACCATATCTTGAC
TGTTCCAAATCGGTTAGCCTCATTTAACACACCCCCGCTTGGACCAACAT
CACACCCAACCCATCCCAGCATCCCACCAAACAACGAACCAGGAAATAAA
CCTAAATAGCACCTGCGAAACGGTAAATACAGGACTCCCGGTACCTTGTA
TCACGGTACTGTACAACGGCATCTACGGTAACCTCATCCCCGGGCAGGGA
ATCGCTCTTTTTCTCCCTCTTCCCATTTTAAAAAAACTGCTCCCAAGTCT
GCGCCGCTATCAGGCAGAAGTTTTAATACCAAACAATCCCCCTCAATACG
TCCTCCCTTATCCTCCGCTGTTGTATCGACCATACAGTATATATCCAGAG
TTGCGTTGGCTATTCCCAGATTTGCCGTGACAAATTGTTACACCATCGTA
TTGACGACGACAACCCTTACGACGACTTCAGCACTCCCACGGGAAGGTCG
CGCGTAACTTACTTGATTGGTGAGATAGGTTACTCGGGCTCACCCAACCC
AACGCTTAAATACCCAGCGACAACGAAGAACCAACGACCAACTCACCATC
AACAAATTTCAAAATCATGGCTTCGAACACGCCAGGAGAATGTTGTATGA
AGGGGGTTATGCACGAGGGCACGCCGAAGGGAGAAATGGTGCAGTTCGCG
GAAGTGGAAACATACATCACCAAGCCTGCCAGCGGATCTAGCGAGAAGGT
GATCCTGCTATTGACGGATGTTATGGGGATTTGTAATAATCCGAAACTCA
TTGCCGACAACTTCGCCGCAAACGGATACACCGTCGTTCTTCCCGACATC
TTCGCCGGCGACAAAGTCCCCCTCCCAGCGGATCGCAAGCCAGGATTTCA
ACTTCCGGAATGGCTAAAGAACCATCAACCCCACCACGTCGTCCCGATCA
TCCAGGAAGTGATGGGTCAAATCCGGGCGGAGCTTAAGCCCCGCAAAATC
GGCGCAGCAGGCTACTGTTTCGGTGCAAAATACGTCACGCAACTCCTCTC
CGGCGAGATCGACGCAGGCTACAACGCTCACCCCAGCTTCGTCACACTGG
ACGAACTCTGCGCCATTAAAGCCCCGCTTGCGATTTCTGCCGCTGAAACT
GACTCAATCTTCACCCCGGACCTACGCCACGCGACGGAGGCCAAGTTGGC
GGAGATCAAGG

Sequences in the Contig:

SY0AAA10YI14FM1 SY0AAA15YB23FM1 SY0AAA16YP08FM1
SY0AAB59YN18FM1