Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1799
Length(NT) : 657
Best Gene Model Blast : Link to GSTUMT00004527001 E-value : 1e-155
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Transcription, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2773 Score: 173 E_value: 1e-13
PFAM Definition: DNA_pol_phi, DNA polymerase phi. This family includes the fifth essential DNA polymerase in yeast EC:2.7.7.7. Pol5p is localised exclusively to the nucleolus and binds near or at the enhancer region of rRNA-encoding DNA repeating units..
Pfam Number: pfam04931 Score: 139 E_value: 1e-09

Sequence:
>Contig1799
TTGGCCTTCCTCATCCCCCCCCCAACCCTACCTACATCTTTATCCCAATC
GCTTTATCCCACACCTATCCATACACCCATCGTGCCAAAAAATGTCCACC
AGAAAGCGTAAGCAAGAAGCCGCTGCTGAAGAAGGCGAGGAGGAAGAGGA
ATTGCAAGCTCTTCCATCTGATGAATCGGAGGAGGAGGAAGAGTATGTAG
ATTCCGGACCCGAAGATTCCGGTGCCGAAGAGGAGGAGGAAGAGGGGGTT
GAGGAGGCCGATGAGGAAGAGGAGGAAGATACGGCTGAAGCCTCAAAACC
GAAGAGGCGCAAATTGGAGAAGGGCGATGAGGATGAGGCGGAAGCTGATG
ATGCTGAGGGGAAGGAAGATGAACCCAAAGACAAGGAGGGAGAAGGGGCT
GAGGCAGAAGCTAAAGCCGAATCGAAAGCTGAGGCGGAAAAGGCTGAGGA
CTAGGACTAGGAGGAAGAGAAATAACCCAGTTTTCCCTACTTCCACTTTC
TCCCTAAGATCAATTGACGTTCGGGATATCATCATCGTTCATATGTACTT
CCACTCCACTATATTTTGTTCATTTTCTCAGAAAAATATTTTTGGAAAAG
GAAAGGGGAAAACAAAAAAGGCCGAATCCAACTGAAAAAAGATAAATGAA
GCGCGCG

Sequences in the Contig:

SY0AAA62YK06FM1 SY0AAA9YH07FM1