Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1798
Length(NT) : 254
Best Gene Model Blast : Link to GSTUMT00011295001 E-value : 1e-123
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein AN5199.2
Accession: ref|XP_662803.1| Score: 280 E_value: 8e-24
KEGG Definition: hypothetical protein [EC:3.4.11.18]; K01265 methionyl aminopeptidase
Accession: ani:AN5199.2 Score: 280 E_value: 4e-24
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG2738 Score: 264 E_value: 9e-25
PFAM Definition: Peptidase_M24, metallopeptidase family M24..
Pfam Number: pfam00557 Score: 132 E_value: 2e-09
Swissprot: Q01662|AMPM1_YEAST
Gene Ontology:
GO:0022626 = Cellular component: cytosolic ribosome
GO:0004239 = Molecular function: methionyl aminopeptidase activity
GO:0006508 = Biological process: proteolysis

Sequence:
>Contig1798
TTGGATCGAGCCGATGATCAACCTGGGCACGTATAAGGATACCACTTGGC
CAGACAAGTGGACCAGTACCACCAGCGACGGCAAGATGAGTGCCCAGTTC
GAGCATACGCTCTTGGTGACGGAGGGGGGTGTAGAGGTCTTGACTGCCAG
ATTTCCTGATTCCCCCGGTGGGATGATGCCCATTCCCGGGATTGATAGGA
ACGGAGAGGGTGGAAAGAAACAGATATGAGAGGCGAAGAAGGGGGGGGGG
GGAT

Sequences in the Contig:

SY0AAA62YI18FM1 SY0AAB31YJ18FM1