Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1797
Length(NT) : 1727
Best Gene Model Blast : Link to GSTUMT00003619001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: 3-ketosteroid reductase
Accession: ref|XP_001272012.1| Score: 769 E_value: 2e-79
KEGG Definition: 3-ketosteroid reductase [EC:1.1.1.270]; K09827 3-keto steroid reductase
Accession: afm:AFUA_4G11500 Score: 747 E_value: 3e-77
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1478 Score: 587 E_value: 5e-61
PFAM Definition: No Hit Found
Swissprot: Q6CJC2|ERG27_KLULA
Gene Ontology:
GO:0050576 = Molecular function: 3-keto-steroid reductase activity

Sequence:
>Contig1797
TTGGCGATACCTCGCAGTTATATACTGACAACACGTAACCACCCCTCTCT
GTCCATCCTCGCACCTAACAGTACTCGTACGGTAGTTGTAAGTAACACTT
GAGGCTCAAATGGCCCCACTCGCCTGTCAGGAATAAAGTTGGGGCGCCAA
CCAGGACCCTGGGGTGTGCTTGCCTGCAGGGTCGGCAATACAAGGATAAA
TAAATTATATTGAATGCCTGCAGCAACCCGGCCCAAACATTCTACAGATA
GGGGTTTCAGGATAACGTTACCTGACAACCACCTTCACCTTTACAGTACC
CCCTTCCTCCCTCCCTACCCCAATTGACCACCAGGAAAACGTATACTCGA
GTACAATAATATTATTGCCATACGTGAGGGAGCTCAAATAGCGGGTGCGA
AGTGATAGTGATGTCGGAGAAAACTCAATTCTATTTTCTGCTCACAGGGA
CCAATAGCGGCCTCGGCCTCTCCCTTGCCCACCGGCTACTAGACAACTTC
CTAACTACGCACCCGGAAAACCACCACCTGACACTAATCATAACCACCCG
CTCGCACGGCAAAGGCTCGGCTACTCTCGCACTCCTTAACAACCACCTCC
GCACCCGCAATGTTCCTAACCCGCGTTACACCCTCGCCCACCACTCCGTC
GACCTCACCAACCTCGTTTCCGTGCACTCCCTTGCCCAAACCCTACGCAG
CACCTACCCACACCTCGATGCCATAATTCTGAATGCTGGAATGGGCTCCT
TCCTCGGCATCAACTGGTTGAACTGCTTCATATCGCTCGCCAAGAACTGG
ATCCAGGCTCTCACGGTGCCCACGTTCAAGATCCAGGACGTGGGCTGGAC
GACGGTGCAGGGGGCGCCATTAAGCGGTGAAGCGATACCGACGGTGTTCG
CGGCGAATGTGTTTGGGCATTACTTCCTCGTGCATGAGGCTATAGACTTG
TTGGCCGGGGGTAACGGGCGGATTATTTGGACGTCTTCACTGGAAGCGCA
TCCGTGGACGCTTTCCATTGATGACTTGCAAGGCGTGCGCGCGAGCCATT
CTTACGAGAGTAGCAAGCGCCTCACGGATGTTTTGGCGTTGACGTCCGGG
TTAGAGTGCACTTCGCCATTTACCGCTTCATTTTTTTGCCGGAAGCAAGT
TGATTATACCGTTGAAACCGAGAAGAAGCAAAATCAGCAGGTTCCAAAGA
TGTACGTCTGCCACCCCGGCATCTGCGGGACGAGCATCATCCCCCTCAAC
TTCATACTTTTCAACTGCATGCTCCTCGCCTTCTACATTGCGCGCTGGTT
CGGCAGCCCCTGGCATACCATATCCACCTACTCCGGCGCGAATGCCGCCT
CCTGGCTGGCCCTCGCGTCGGACGACGAGTTGGAGGGTATGCAGGCTCAG
GAGATAAAGTGGGGCAGCGCATGTACCAGATCTGGTAAGCAGATGGTGAA
AGTTACCCATGTCGAAGGTGAGGAGAACAGACCCGAGTTTGAGGAGCTCG
GTAGAGAGTGCTGGAAGCAAATGGAAGAGTTGAGGATGTCGTGGAAGGAG
AAACTGGAGAGGGCCACGAAGTAAGCCTTCAGGTCTATCATATTTTTGAG
AAGCAGCCCTTCTTGCTTTTTCTGGGTATCTTGTTTGTTCTTGGGAAATG
GTTTCTACTTGCTTCTTTTTCCTTTGCTCTCTTAATTCTTTGTCCCATTG
GCATAATAGCAATTTTTTCTTCTTCCT

Sequences in the Contig:

SY0AAA38YD17FM1 SY0AAA62YH22FM1 SY0AAD21YJ07FM1
SY0AAD38YL06FM1 SY0AAD39YC09FM1 SY0AAD48YM16FM1
SY0AAD4YA09FM1 SY0AAD60YM02FM1