Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1796
Length(NT) : 1130
Best Gene Model Blast : Link to GSTUMT00007744001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein SNOG_10185
Accession: ref|XP_001800467.1| Score: 666 E_value: 8e-68
KEGG Definition: predicted dehydrogenases and related proteins
Accession: aor:AO090102000225 Score: 558 E_value: 1e-55
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2742 Score: 211 E_value: 1e-17
PFAM Definition: GFO_IDH_MocA, Oxidoreductase family, NAD-binding Rossmann fold. This family of enzymes utilise NADP or NAD. This family is called the GFO/IDH/MOCA family in swiss-prot..
Pfam Number: pfam01408 Score: 185 E_value: 1e-14
Swissprot: Q04869|YM94_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1796
TTGGCCATACTATGGTACAAAGATACTAGACCCAAGTGTCTAGTGCATCT
CCCAAACTATTCAGAGGCATCCATCTCATGCACGGCGGGGTAGGGTCCGG
GAAGAACCACATGACCATCCAGCCCCGTCTCCGCATTCTCAGTGCAAACA
AACGGACACTCAACTACTCCCGACCCACCCTATTCTCGTTTATATCACTA
TCACACCGTTTCCACAAAACAAAACAACCCATCGATATAACATAGGATTA
CAAAATGGCTCCAATCGGGATTGCTATTCTGGGGTGCGGAATCTTTGTCC
AGGAGGAGCATCTTCCAGCAGTAGAAGCCTGTTCAGATGTAGTTCTGAAG
GCTGTTTACTCCCGTTCGGAAGCCTCTGCGAAAAAGCTTTTGCAGGCGAA
GTCAGGAGTGGATATCTACTCTGACGATTCCGAGAATGGCCTGGGCGTAC
TATTGGCGCGCTCCGATATCCAGGCCGTGATCATCGCGTAAACATCTCCC
CCCATGAATTAACCCGGTACTGATGAAACCCCCCGAACCAGTCTCCCTAT
TACCATCCAACCCGAAGTAATCAAAAAAGCCCTCGGAGCCGGCAAACATG
TGCTGAGCGAGAAGCCCGTTGCGAAAGACCTAGCACAAGCCCGCGAGCTA
ATATCCTACAAACAGTCCTATCCGGACCTAAACTGGAGCGTGGCGGAGAA
CTTCCGCTTCCAGGAAGCCTGGCGACATGCCCACCGGGAGATAACCGCCC
TCGGCCGGGTCATCAACTTCCGCTCGCGGGTCTGCTGGCTCGTCACCCCA
GGCTGGAAATACTACGAAACTTCCTGGCGCAAGACGCCAGACTACCAAGG
TGGCTTCCTCCTCGACGCCGGAGTGCACTACGCTGCAAGCATGCGCATTC
TACTATCTGACGAAAAGATAGTGAAAGTCTCTGCTTTCACCGCCTCAAAT
TTCGAGCACTTGCCCCCCGTGGACACCATCTCTGCTATCTTCAAGACAGA
TAAAGGCGTTGTGGGGAGCTTCGAGGTCAGCGTCGGAACGACCTTCGAAG
GATGGGAGTTTGCGGTTGCGTGTGAGAATGGGAGTGTCACAGTGCGGCCT
GTCAGCGAGGTTGTTATTCTCAGGAGCCAA

Sequences in the Contig:

SY0AAA62YH12FM1 SY0AAB54YB16FM1 SY0AAB60YC21FM1
SY0AAC36YP24FM1 SY0AAC54YG07FM1 SY0AAC61YN24FM1
SY0AAD33YH11FM1 SY0AAD40YL21FM1 SY0AAD40YO12FM1