Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1795
Length(NT) : 1510
Best Gene Model Blast : Link to GSTUMT00004726001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_05682
Accession: ref|XP_001592761.1| Score: 860 E_value: 4e-90
KEGG Definition: hypothetical protein
Accession: ang:An18g04110 Score: 843 E_value: 2e-88
KOG Definition:
Classification: [Nuclear structure, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1993 Score: 606 E_value: 3e-63
PFAM Definition: No Hit Found
Swissprot: Q9UI26|IPO11_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1795
TTGGGCTCGAAACCTCAAGCGGAGCGTAGACGAGTGGGAGTTTCGGGTCG
AGTCGTTTCTTCCATATGTGGACGATTTGTTTGCGAAGCTCATGAGTTTG
ATAGATGAGGTAGAACAGACAGAAGTAAGAATGGGACTGTTAGACGTCAT
TGGGGTTGTCGTAGAGAGGCTGGAGCACAGAATAGCTCCCTATGCGGAGA
GTATCATTACCATATTGCCACCGCTGTGGGAACAGACTGGGGATGAGCAT
CTGTTTAAACAGGCGATCCTAACCATTCTCACGAAGCTTGTCTCAGCAAT
GAAGGATAAGAGCTTACAATATCATCATATGGTGATCCCGCTTATTCGGT
TCTCGGTGGAGCCAGGCTCAGGTATGCAAGTATATCTCTTGGAAGATGCC
CTTGATTTATGGGAAGCAGCCATCAGAGCTACGCCTGCGCCTGCGCCACA
GGGGCTGCTAGATCTTGTCTCTTACCTTTTGCCCTGTGTAGATCTTGGAA
CCCTAACCCTCAGGAAAGTGCTTGACATAATTGAGAGCTATGTCATTCTA
GCACCCCGCGAAATGATTGAAGTGCATCGTGCGGGGATGTTTGACGCTTT
CGCTTCTTTGCAGGGCACATTAAAGCCAGAAGCGAACGGCATTGTCACGA
ACGTTGTTGAGATTTTAATCAGGGCTGCTGAGGCACTGGGTGGAGAGCAA
GCGCTGGGAGTAGTTGGAAATGAGTTGATTCGGAGCGGCTTCTTACCAAC
CCTCCTTGAGGGCATCGAGAAGAGCCATGAAGCGCATCAGACTACCGGTC
CCAATAAGCGGTACGCGCCATTGGATACTATCGTAATGACGGACTACTTC
TCGGTATTATCCAGGATGGTGTTAGCAAGCACTACGATGTTTGCAGAGAA
CGTGAGAGTTTGTGCAGAGAGGAAGGGTCGCACAGGAGAATCTGACATGG
AATGGATTCTAGAGGAGTGGTTTAGACACTTCGGAAACATTGGACATCCA
AAGCAGAGAAAACTTGGCTGCATTGCTCTGACAAAGCTCCTCGAGACCAA
CCAGCGGTGGATTCTGAAGAGGCTGCAAGATCTCATGACCGTTTGGACTG
ACGTTGTCACCGAACTTCAGGAAAACCAGGGAGCCGATGCACTGATCTAC
TGGGGGGCTGGACAAGAGGGCGCATCCGAAGACCCTGAAACCGCTGAGAG
AAGGCGCAGAAAGGAGCTTCTCATGTCGGATCCGGCCCAGTCGATAGACA
TTGCAGCATTGGTCAAGCATCATCTAACTAAAGCGCAGAACGAGAATGGT
GGGCCAGAGTCTTTCAGGAATGACTGGGCGGTAAATGTGGACGAGCACGT
ACTCGCAGATTTCAGAAAATTGGGGATTTTTTAGTCCATTCGTCCGTCCA
CACAATACCGTGTACTGTACATAGTGTAATTGCTGTGCGGGGTCTCTTTT
GCACCGTACGACCTAGTAGGCAAGGTGGGGATTATCATTACTATCAAACT
TTTATCATTT

Sequences in the Contig:

SY0AAA44YI17FM1 SY0AAA62YG15FM1 SY0AAB35YI10FM1
SY0AAB3YG16FM1 SY0AAB45YP07FM1 SY0AAC35YN10FM1