Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1794
Length(NT) : 1466
Best Gene Model Blast : Link to GSTUMT00003138001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein BC1G_11482
Accession: ref|XP_001550274.1| Score: 582 E_value: 7e-58
KEGG Definition: hypothetical protein
Accession: ncr:NCU07718.1 Score: 519 E_value: 7e-51
KOG Definition: No Hit Found
PFAM Definition: Acetyltransf_1, Acetyltransferase (GNAT) family. This family contains proteins with N-acetyltransferase functions such as Elp3-related proteins..
Pfam Number: pfam00583 Score: 120 E_value: 6e-07

Sequence:
>Contig1794
TTGGATTGAATACCCACCCGCCCCAAATCCCTCTTCCCTGTAACGGGTCC
CAACCATTTGTCTTTCCTTCATTAGCTCATCGGAAGAAACGAGAAGGAGA
AAAAAAGAAAGAAAAGAAAAAAGAGAGAGAAAAAGAAAAACAAGGATCTT
TTTCCGTCGAGGAGAATTGAAGGGAACCGTCTCTCGTCACGGGTACTGTA
CCAAGCGCAATAAATAACAACCTCCTACGCCTGCCTGCCTACAGCCCACC
ACCAGGATACGTAACCTACCTATCTCCCACCTACTTATAAAGGTTCCCTC
CCCCACTACTACACCGACCTACTGCACCTTATCCAACCCTCCCAACAAAC
AATCTACTACTCGATTAATCTTTCCTTCCTTGACGGAAGAGCCTCATCAT
ATACACATTACAACCATGTCTACAACAACAACAACAACAACAACGACCTT
AACATTACCATCCTATGCCTCGGATGAGGTTCGAGAACTCGGAATTGAGG
ACTGCAAGGCGGCAGCCGACACGCTCGCGGAAGCTTTCTTCAAGGACGAC
GTTGCATTCTACTTTCTCGATACCCCCGACAATGGTGGAAAGACCAGGGA
TGAGCTCTACCCATTACACCGAGAGATTCTGGAATACATCGTTGCAGCAC
ATTGCTACAACGGTCTTGTCCTGAGCATAGGGGAGAACCATGAAGGCGTA
GCATTGTGGATGCCGCCGGGACAAAACATGGATGACTGGTTCACAATCTT
CCGGAGTGGTATGTGGAGGCTGTGGTACAAATTGACGAAAGAGGGAAAGA
GGCGGTATTTCGACGAGTTCATGGAGATCCTTCATCGCACCAAGGAGTCA
GTTATGGGGGCGCAAGATAGTGACACATGGTACTTGGTCTATGTCGGTGT
CGTTCCCAGTGCGAGAGGGAGGGGTTACGCTAGAAAACTCATTGAATACG
TGACAAAAAAGCTCGACGCAGAAGGCGGTAAACCATGCTATCTCGAAAGC
AGTCATCCCAGAAACGTAGCCATGTACCAGAAACTCGGCTTCGTGAAGCA
GCGACATATAGTACTCGGTCCTGACTGCAGCAATCCTGCTCCTCTCGACA
TCATGGTCCGTCCACCTATGGATCGTCGGCGAGAAAATTACTCCTCGAGT
CGCAAAATGTCAGTGGCAACCGGAGTTGGTCGGGTCCTCTCTGCATAAAT
GCATAAACCGGACCCAATCGGCAGAAAAAAAAAATTTAAAAAAAAATCGC
TACTTTCCCTCTCAACTTACTACAACACTTTCTCCGCCTCCATCTCCTCC
GTGTCCGTAAGGATCCCCCATTCGACTGGAAGGAGCGATAAACTTTATGG
CATTGTAATTATGGGCTTTGGCAAAGGGGACGGAACAGGGACGAAATTTG
GATGGATGGTTGATTTGCATCGGGTGGCGACCGACATTCATGAAAAGGTG
TTCTTCTCCCGGGAGT

Sequences in the Contig:

SY0AAA55YI22FM1 SY0AAA62YF07FM1 SY0AAA8YJ17FM1
SY0AAB35YP06FM1 SY0AAB46YN12FM1 SY0AAB55YA15FM1
SY0AAB56YJ15FM1