Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1793
Length(NT) : 674
Best Gene Model Blast : Link to GSTUMT00009848001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_12478
Accession: ref|XP_001586491.1| Score: 836 E_value: 7e-88
KEGG Definition: hypothetical protein
Accession: mgr:MGG_06896 Score: 829 E_value: 2e-87
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Posttranslational modification, protein turnover, chaperones, Signal transduction mechanisms].
Kog Number: KOG4626 Score: 463 E_value: 3e-47
PFAM Definition: No Hit Found
Swissprot: Q8CGY8|OGT1_MOUSE
Gene Ontology:
GO:0005622 = Cellular component: intracellular
GO:0008080 = Molecular function: N-acetyltransferase activity
GO:0005515 = Molecular function: protein binding
GO:0006493 = Biological process: protein amino acid O-linked glycosylation

Sequence:
>Contig1793
TTGGATGTAATCCTTGGAAACTTTAACCAGCTATATAAAATCGAGCCAAC
AACCTTTAGAACCTGGCTCCGAATCCTCTCCCGCGTGCCCAAAGCCGTCC
TCTGGCTCCTCCGTTTTCCCGACCTCGGCGAGAGCAACCTAAAAGCACTC
GCAGTGGCCTGGGCGGGGGAAGAAATCGCCTCCCGCATAATCTTCACAGA
CGTTGCTCCAAAGCTCCAACACATATCCCGAGCACAAGTCTGCGACATCT
TCCTCGACACGCCGGAATGCAACGCACACACTACTGCTGCAGACGTCCTT
TGGTCTGGAACGCCATTACTGACCTTCCCACGACACAAGCACAAAATGTG
TTCCCGCATCGCCGCTTCTATTCTCCGTGCTGCAGTCCCGCAGACGCCGG
AGGGGAAGGCGATGGCTAATAGTCTTATTGTTGATAGCGAGGAGGAGTAT
GAAGACCGGGCGGCGGCGCTGGTGTCCAATCTCGTTTACGATAATGATGA
GGGGAGGGGAGTTGGGCAATTGGGGACTATCAGGCAGGTGCTGTTTGAAC
ATCGGTGGAAGTCGGCGCTCTTCGATACAAAACGCTGGGTGCGCGATTTG
GAAGATGCCTATCATGAAGCATGGAGAAGGTGGGTTAGTGGTGAGGGGGG
GGATATCTATCTTGAAGGGGTTCA

Sequences in the Contig:

SY0AAA62YB19FM1 SY0AAB51YG18FM1