Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1792
Length(NT) : 902
Best Gene Model Blast : Link to GSTUMT00008879001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: tRNA dihydrouridine synthase (Smm1)
Accession: ref|XP_754775.1| Score: 797 E_value: 4e-83
KEGG Definition: tRNA dihydrouridine synthase (Smm1), putative [EC:1.-.-.-]; K00540
Accession: afm:AFUA_3G08390 Score: 797 E_value: 2e-83
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2334 Score: 750 E_value: 3e-80
PFAM Definition: Dus, Dihydrouridine synthase (Dus). Members of this family catalyse the reduction of the 5,6-double bond of a uridine residue on tRNA. Dihydrouridine modification of tRNA is widely observed in prokaryotes and eukaryotes, and also in some archae. Most dihydrouridines are found in the D loop of t-RNAs. The role of dihydrouridine in tRNA is currently unknown, but may increase conformational flexibility of the tRNA. It is likely that different family members have different substrate specificities, which may overlap. Dus 1 from Saccharomyces cerevisiae acts on pre-tRNA-Phe, while Dus 2 acts on pre-tRNA-Tyr and pre-tRNA-Leu. Dus 1 is active as a single subunit, requiring NADPH or NADH, and is stimulated by the presence of FAD. Some family members may be targeted to the mitochondria and even have a role in mitochondria..
Pfam Number: pfam01207 Score: 398 E_value: 2e-39
Swissprot: O74731|DUS2_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig1792
ATTTAGTATGGGGCCCTGAGACGGTGGATAAGGGAATAATCGGAGCACAA
CGGGTTGTAAACTCAAAAATCAACTGTATCGACTTTGTTAAACCGCAGAC
TGGAGGACAATATGACGAGAAAGTCATTTTCAGAACTTGCCCGGCGATAG
AATCTGGGAAATTGATATTTCAGCTTGGCACTGCATCGCCGGAGTTGGCG
GTGGAGGCTGCGAAGATCATTGTGGGCGATGTGGCGGGAATAGACGTCAA
CTCTGGATGCCCGAAGCATTTTAGTATTCACTCCGGAATGGGCGCTGCTT
TACTCAAGAACCCGGATAAGCTTATTGATATCCTCACTTCACTCGTCACA
GAAGTAGGGGTGCCTAATTCTGTCCCTATTTCGGTCAAGATTCGCCTCCT
GGAGCCACACACGGACACTATCGGCCTAGTACAACGGCTCTGCACGACCG
GTATATCCCGAGTAACCGTTCACTGCCGGACAATTCCTATGCGCCCTCGC
GAGCCAGCTATCCGGGGGGTTCTCTCCGAGATCGCTAATGTTTGTCACGA
AGCTGGGATCGAATGTTTTGCAAACGGGGATGTTACCTCTCGAGCGCATG
CTGAGGAGCTTATCGAAAAGCACGGTGTGGACGGATGCATGATTGCTCGC
GCAGCGGAAACAAATCCATCCGTTTTTCTTTCGGGCGAGAAACTTCCGTG
GCGAGATGTTGCCAGGGAGTATATGAAGATAGCCGTGGAAGTGGACAATC
ACTTTTCGAATATCAAGTTCTGCCTATTGCACATTATACCTGGAAAGACA
GATCTATACCCTCCGATATCGAGGTCTAAGACTGCCCGACAAATCTGCGA
AATCTTGGAGATCCCTTACGAACCTCCAGCGCCAAGGGTCGAGGAGACGA
CT

Sequences in the Contig:

SY0AAA62YA20FM1 SY0AAC32YJ12FM1 SY0AAC51YE06FM1