Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1791
Length(NT) : 1714
Best Gene Model Blast : Link to GSTUMT00006772001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein CHGG_00960
Accession: ref|XP_001220181.1| Score: 969 E_value: 1e-102
KEGG Definition: hypothetical protein [EC:4.2.99.18]; K01741 DNA-(apurinic or apyrimidinic site) lyase
Accession: mgr:MGG_10609 Score: 919 E_value: 3e-97
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG3997 Score: 1017 E_value: 1e-111
PFAM Definition: AP_endonuc_2, Xylose isomerase-like TIM barrel. This TIM alpha/beta barrel structure is found in xylose isomerase and in endonuclease IV (EC:3.1.21.2). This domain is also found in the N termini of bacterial myo-inositol catabolism proteins. These are involved in the myo-inositol catabolism pathway, and is required for growth on myo-inositol in Rhizobium leguminosarum bv. viciae..
Pfam Number: pfam01261 Score: 286 E_value: 3e-26
Swissprot: P50525|APN1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0008311 = Molecular function: double-stranded DNA specific 3'-5' exodeoxyribonuclease activity

Sequence:
>Contig1791
TTGGCAGTCAACCAGTCCCCTGACCTCTCCCCATCACCGAATCGAAAGAA
GAAATAAAAATCAGATAAGAAAGCGAAAAACTCTCTTCCCCCTCCGCCCT
GCACTACATTTTCGTCATTATTACCAGATTACAAGGTCTAGTCGGCTACT
AAAATGTTTGCAAAGATGGCAAGAACCACCCGTGCAGCAGCCGCGGCCGC
AAAAAAAAAGAAGCAAAAAGAGGAGAGTTCATCGCAAGTATCTGGGCTCG
ATGAAAAGGAGGAATCGGGGGACGAGGAGCTCGGAGTTTCAGTGCACAAT
ACACAGACATTTGCTGCGGCGGCCAGTCAGGTTACAACTGCTATCGTTGA
GTCTGCGAGTTCGGCGAAGACTGTTTCTACCTCATCAAAGAAGAGGGGGG
CTGTTACCGAGGAGGAAGAGGAGACGGTCAGAGTTATTAAGAAGGCTCGC
GGGGAGAAGGACGAGATTATGATTCCCGCTGCGAGGACCGCAGGGGTAAA
GATGATGGTTGGGGCTCATGTCAGCATGGCTGGGGGTGTTCAACATGCCA
TCGCGAACAGTTTGAATATAGGAGGGAACGCGTTTGCGCTGTTCTTGAAG
AGTCAGCGAAAGTGGACGAGTCCAGATATGAAAGAGGCAGATGCAAAGGC
TTTCCGAGCGGGTTGTGAAGAGAATGGATTTGATCCTAGGAAACACATTC
TCCCTCATGGATCGTACCTGATAAACCTTGCCAACGGCGACGCCGAAAAG
GCGAAGAAAGCATACGATTGTTTCCTCGATGACCTGAAGCGTTGTGAGAG
GCTGGGGATTGGTCTGTACAATTTTCACCCCGGATCAACGCTTGGACTCT
CGCGCTCGGAATCGCTCACTCGTGTTGCAAAGGCGCTCGATAAAGCACAC
TCCGAAACTAAGTACTGCATCACAGTATTAGAGAACATGGCCGGAGCTGG
GAATGTCATTGGTGGAAAATTTGAGGATTTAAGAGATATTATTGCGAAGG
TTAAGGATAAGGATCGTGTGGGTGTTTGCCTTGACACATGCCATTTATTC
GCAGCCGGTCACGACATCCGCACCCAAGAGTCCTATGACAAGGTGATGTC
CAACTTTGACCGAATAATCGGCCGCAAATACCTCGTAGCTCTCCACATCA
ACGACTCTAAAGCTCCCCTAGCCTCAAAGCGAGATCTGCACCAGAACATA
GGCCTCGGCTTCCTTGGTCTTGAACCCTTCCGCTTAATCATGAATGACGA
GCGTCTCGAGGGTCTCCCGCTAATCCTCGAGACGCCAATGGAAGAGGAAA
AAACGTGGGCAGAGGAAGTCAAGCTCCTGGAATCCCTCATTGGAGTGGAA
GGCGACGACCCGGAGTTCTTGGCGAAGGCGAAAGAATTGGCGGATAGGGG
TGCAGGCGAGAGGAGGACTGCTGGGATTGCAGCACAGAAGAAGGCTTTTA
AGGCTGTTGCCAAACCGAAGAAGCGGGGAAAGAAAAGTACGAAGAAGGGT
GGGAATGAGAGTGGTGAAAGTGATGATGGGGAGCACAGCTGTTAGGTCCT
ATGATGAAGTTGTTTCAAAGTCTTTTTTGCTTATCCTGGCTTTTCTTTTC
CTTTTGCTCGATTCTTGTGTAGCTATTTCTACATGGTTTGCGCTATTCGA
GAACTTGTGTATATGATCGATTGTCTGACTTGTTGGGTCTGTTGCTTGGC
TGGAATTTCTCTTG

Sequences in the Contig:

SY0AAA12YI09FM1 SY0AAA61YO19FM1 SY0AAB14YA08FM1
SY0AAB14YD12FM1 SY0AAC45YL13FM1 SY0AAC55YJ16FM2
SY0AAD24YG07FM1