Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1790
Length(NT) : 837
Best Gene Model Blast : Link to GSTUMT00001690001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_14125
Accession: ref|XP_001584842.1| Score: 472 E_value: 2e-45
KEGG Definition: lipase, putative [EC:3.1.1.-]; K01066 esterase / lipase
Accession: afm:AFUA_6G02710 Score: 419 E_value: 1e-39
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1790
TTGGGGAAAAGAAGAAAAAGAATTTTGTCTCCCAGTCCCTCCTTCCTCTT
GGAAAATCGAAGGAGTCCTCTTCGGAGGATGGGGGCTTGTTACTAGGAGC
CGATTCACCAGAACTTCGCTTCATTGAGAGTCATGCACGAACGTCTTCAA
GAGGCGGGATTTTTCGCCGGGAATCCTCGGTTTCAAAGTCGAGCGGCACT
TCAAGTGCTCAACAGCGGGATTCTTTGCTAGGGAGGGCATCCACATCCCC
ACATCTCGGCCAAGCGGATAATCACATGTCACCAGGCCACTCCCGAAACG
GGTCCTACACACCATCGATATACACCATTCATACGTCGCACTCCCAAACC
TCACTAACCTTGGAATCTTCTACCCCGCTCGTATTCCCTTCGGGCCATCT
AATAGAAAACCTTTCTAAATATATGCGGTTTGCATCAGCGTCATATGGCC
AGAAGTTCTTGCGCTTATTTGGTATTGGAGATGCCCCAGCGGCATTCCCC
GCTACTGCCAGTCATCACGCGGAGCATCACTCGTTCTCATATCATACGAG
TTTACCAGTGGACACTATTCTACTCTCGTCGTTTACGGATCCAGGCGGTG
GATATGATATAGATGGTGAGGTGAACACCGGAATTCCACTTGTTCACTTT
GTTGCGGTGGATCACGGGGCACAGGCGATTGTGGTGACCTGCAGAGGAAC
ACTTGGACTTGAAGATGTATTAACTGATTTAACCTGTGAGTACGCGGACT
TGTGGCTTCGGGGAACCAAATATCGGGCCCACAAAGGAATGTTGAACAGT
GCGCTGCTCTTGATTAAAAAGGATTCTCGGCTCTTGA

Sequences in the Contig:

SY0AAA61YN17FM1 SY0AAC34YL11FM1 SY0AAC47YD09FM1