Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig179
Length(NT) : 967
Best Gene Model Blast : Link to GSTUMT00001368001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 112 E_value: 3e-06
PFAM Definition: No Hit Found

Sequence:
>Contig179
TTGGCCCAACTTTTTTGTACAAAGTTGTCCCCCACACCCAAACACTAGAA
GCACAGCAACCCCAATCCCCTTCACCCACACAACCGCCTCCACAAAATTC
CCGAAAACGCGCTGCATCCGGTCCTGAGAACGATGCCCCTGTTCCTCCAG
CAACGCCGATGGCCATGGCTACGACCACGGTTGTAGGCCCTCACCCCTTG
CGGACAAATTCCCCTGCTGTGGAGAAGAAGTTGGAGTGCTTGCCCACTGG
AAAGTCGAAAATGGCAGCCAAACCGACTGCCGCCAAACACAAGTTCTCGT
CAATAGACGGTCCTCAAATTTACTACGATGGTGAGGCTCAACAGACATTT
TACGATTGCTGGACCACGCTTAATTCTAAGCGGGGATTGCTGAGGAAGGA
GATGATGACTATTAGGAGGAAACGGGTCATGACATTACCGACGCATAACT
ACGGTTATGATGACGACTCCGAGGAGGAGGGATCTGATAAGGAGTCTGAC
CAGGGGCCTAAAGAGACCGAGGAGGAAAGGTTGAAGAGGGAGGAGGAGGA
GCGGAAGAAGGCTGAGGAGGAGCGATTGAAAGCAGAGCGGGAAAAAAAGG
CGGCGGAGGTTCTGGAGTACATCGACTCGTGTCTGGATAAGGCGTCGAAA
GGGTGTGAGAATGCTGCCTTCTTGTGGTTGAAAGGGGATATCTGCGCAGG
TCACATTTCTTTCATCAATTCGAGAATGCAGGAGGCAGTGGATCGGATCA
ACCTAGAGATAGATAAGATGAAGCCAGTCGCGCCTCCTGCTCCCGCTCCC
GCCGTGGAGGATGAGGGTATTGGTGCAGAGATGGATATTGACGCTGACGA
TACACCGACAACCATTGCTCTACCACCTCGGAAGATGGACACTGCGATGC
ATGACTCCAGAGTAGTCGGAGTCAGCTAACACCACCCTCTTGGTTTCATA
CCAAGTATGTCTTTTTT

Sequences in the Contig:

SY0AAA15YM21FM1 SY0AAA16YI06FM1 SY0AAC14YM17FM1
SY0AAC35YP03FM1 SY0AAD42YF12FM1