Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1789
Length(NT) : 668
Best Gene Model Blast : Link to GSTUMT00011746001 E-value : 1e-135
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_10204
Accession: ref|XP_001588657.1| Score: 128 E_value: 8e-06
KEGG Definition: hypothetical protein
Accession: mgr:MGG_11878 Score: 128 E_value: 4e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1789
CCATTGAGATCAATCCGCACGGAAGTTCCCTCAACAACAGAATTTGTCCC
AACGGCCCCCGCAGGAACTTATTCGTGAGAAACAGAGCGTGGGAACTCAA
TGGACGATATCTTGAATGATTTACCGCTTCCTTTTGAAGACAGAACACTA
ATCTGACCTCAATTACCCTCTTTTTGCTTAAACTTGTTGAAATCTTGACC
TCATTTTTTATATCCTTTTATATTTTTATATCTTTTTTTGAAACTCGGCT
TCTGCTTTCAAAATCGATATCTTTTAATCCCCTTTTCTACTGAGTTCCTG
ACTTCACATTTCCACTGAGAAACCCGCGCTATGCCTGGTGAAAGGGTGAC
CCTGAATCCACCAGGGGCGGTTGCCAAAGACGAGCCCGCGCCTATCGGCG
GAGATGGTGGTAGCGGGAGGGGTTTGGTGGTGAGAAGACCTCAAAGAATT
CTGACGGGCAGCGAGTTGTTCGCGAAGAAGTATCGGACCGAGGTCGCGGC
GAGTGCCAGCAGCTGTGTTTCCACTTTTATCGCCTTTCCCCTCGATTCGA
TAAAGACCCGGATGCAAGCGTAAGTGCTTCTCATCAATGAATACTATCCC
AATGGAACATTTGAAGCTTCTCTTGAAGCTCGAACACCCTATCATGTGAT
ACAATCTACCCTCTGACA

Sequences in the Contig:

SY0AAA61YN07FM1 SY0AAB46YL21FM1 SY0AAC13YI13FM1