Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1788
Length(NT) : 804
Best Gene Model Blast : Link to GSTUMT00000476001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1788
TTGGCTCTCCCCTTCCCCGAAAGTTCAAATTTATCTTTTTCACAACGCCA
TACAGCCCATACCGCGACCGTGATCGTACCGTGTTATTATATCCCCATAC
GCACACCCCGTGTCTTATCCTGTCGGCGCTTGGAGCCGATTATATACTGG
GTTCTGTCCTTGTACTTGTCCACAACTAAAAGGGGAGGGAAGGAAAGGGA
GAAAGGAAAGGAAAACATCTACAAAGCATCTTTTTCACTCTTCGCAATAT
CTTCCTTATTTGCTTCACAAAGCGGAGGAAAGAACGCGACATAAGGAGAA
ATGACCTTCAAAAACATATTCAAGAAGGACGGTGGTGGAAGTAGTGGTAG
TAGCAAGAAGGAAGGAGGGTCAACAACACCACCGCCACCAACACAAAATC
CCGAGTTCACCTTCATCCGCAGCGATACCAACACCCAGGACGTCCTGAAC
CTCCACGATCGCAACCATAACCACAACCAGCACCAGCAGCAAGATAAAGG
CCGCCTATCACTCGACCGCCCGCACTCCTCCTCCGGACGTCCCAGATCTC
CCAGCAAACTAAGCCTCTCCACTCTATCCCCCCGGCGCAGATCCAATTCG
TCGGCGCACGTGCCCGCGGACTTACCCAGCATCTCGAGCACCGGTGACAA
AGAGCAGCAATGGGAGCTGCGGGCGGCGAAACTTGCTCAGAGCGGGCAAC
CGAGTCCCGGGATTGTGCCAAGGGGGTATGGTGAGGAGGTGGTTGCTCAC
AGCGATGTAAGCTCCTTCCCTTTCCCTTTTTTCCCTTTCATTTTCGTTCC
CCAA

Sequences in the Contig:

SY0AAA61YM16FM1 SY0AAA9YA07FM1 SY0AAB54YL11FM1
SY0AAC31YA12FM1