Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1784
Length(NT) : 2787
Best Gene Model Blast : Link to GSTUMT00003504001 E-value : 0.0
Numbers of ESTs : 210

Blast Results:

Nr Definition: zinc finger protein
Accession: emb|CAA67549.1| Score: 821 E_value: 3e-85
KEGG Definition: hypothetical protein
Accession: ang:An16g07795 Score: 784 E_value: 3e-81
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2462 Score: 135 E_value: 2e-08
PFAM Definition: No Hit Found
Swissprot: Q5U2T6|PLAG1_RAT

Sequence:
>Contig1784
TTGGCAAGATGTTATCCGTACCCACCTCATCCAACAACATAGCCCCCATC
CGATATTTAAGAGCATCACTTCTCCCGATCAGCGAAATCGACCCGGGGTT
GGGAAAAAAACTACAGTATCTCGAATACAGGCTCACTGGAAGGGCTTTTC
GTTTAAAAAGAAAAGGGTTGAAAGCTTCTTTCCCACGAAACATACAACAC
CGTTCAGCTTGACTTCTCGATTTCTCGGAAAATTGATTTGACGAGAGAAA
AAAGAAAACCATACTCGAACCTGTCAGCCCAACGTTCGGTTTCAGTTGAG
CTCAGTTCAGCTTGGATATGGCCGCATCATCATCATCACAAGCACCCACA
TCGGCTTCAATACCTACCAAGGACACCACAGGAATGGCAGACTTTGTGCT
CTTTGATGATGACCCTTTATATCAGGAGTACCGACCGCGCTACGACAATG
GAGGATTCCCTCAGTCGGGTGTAGATTCTTACGTCGCTATGCTGGAACAA
CCGAGTGAGGATCATCAACCAAAGTTATACATGGCCGGGCTACAGCCCGG
CTCGACCTCCTTCGAGACCTACCCTCCATACGCCTACGATGAGGTACCAT
TGACCATGGGGTACGAGCCCGGACCAGCTCCAGGCGTGTTGATTCACCCT
CCCACCCTACCATACTCACCTCACGGCAACATCACAGCGAGCCTGGAGTA
CCGAACACCTATTTCCCCGGCTACTTCGGCTGGCGGACCGGAAGGCAGCA
GTGCTGGCTCGGAGGCTGGGAGCACAGGAAGCCCATACCCACAGCAAATT
GACGACCCGTTCAGTTCGGTGTATGTCGATATAGATCCATCATTAATCAT
GCCCTCACCGTCGCAACAATTCGAAGACCCTTGTTCGGCCGCGTCATCGC
GAGGTTCGCCGAGTTGGCACAGTGCACACTCACCTCCTCCTACCTCGAAT
CCTTCGTCGCCAGAATTGGGAAAGCGGAGTGGGGGAAGGTTGTCGCCCTT
GAGGCAGTACAGGACAGCACCATACCCGAGCCGGAGATTGAGCGTTACTT
CACAGAGCTCTTCTCGCAGCTATGGTTCGCCCAGTGGGCCGTCGGAATTG
GAGGATATGTATCCAGCGGCACCCGGTGACATACCGCGAAGAGCTCCAAG
TAGCAATGGAAGTGGAACGGGGAAGGATACTCTTTGCCCGGAGTGCAAGA
AGTCGTTTAGGGATCTCAAGGCACATCAACTCACACATCAACTTGAAAGG
CCAGTTAAGTGCCCCATAGCGACATGCGAATACAGCAAGAAGGGATTTGC
AAGGAAATACGATTGTCAACGCCATACATTGACCCACTACAAAGGCACCA
TGGTCTGTGGCTTTTGCCCGGGCAGTGGATCAGCAGCAGAGAAGTCCTTC
AACAGAGCCGACGTATTCAAGCGCCATTTGATGTCGGTCCACAATGTAGA
GCAGACCCCACCCAACTCTCGTAAGCGTCCTCCAACAAAGACATCACCAG
CCGAGGACCGCTATGCCGGAGCTTACGTTACTGGAAAGTGCTCGACCTGT
TCAATCACCTTCGCCACGGCCCAGCAGTTTTACGAGCATCTCGACGAATG
CGTGCTATCCAAGGTTGTTCAAGAGGAACCCGCAGCAGCATTCAACGAGA
TGAACCTGGACAGCGTAAAGCTCTCCGACATGGACCCCCCATCATCAAAC
CCCGCAGACCCCACCTCCTCTGATAGTGAAGACGAGGATGAGGATGAGAA
AGACACAACCTTCAATCCGGCAACCAACAAATCAGCCGCCAAGATCCGCA
TAAAAAAGGGAACTATCAAGCACTCCGGCTCCGGCGCCGGGAGCACGCAG
AGGTGACAATCAGCCCACTCCCGCCCACGAGCCGGGAGTGCCAAAACAAA
GACCATTCGCCGCAAGCGCAAGAATTTTCCGGCAGGGTGGGGATGTCAGC
CTGAGCAGATGGTCACGAAGAGACGCTGCCTGATGGTATTCGATGGACCA
AAGTTACTCTGCAGAGACGAGATGATGATGTCAAACGAGTGGGAAGTGCG
TGCTCAGTTGGGCGGTAGCGGTGGCAGCGATGCTTACATTTCCGATCTGG
ACTTTTGGACGCTGCGCCGGGCGGAGGCTTTCTTGGATGCTGCACCCAGT
AGGAATCCGCAGGGGGCTGCCGTCGGAGAGGTTAGGTAGTCCCTTCTGTG
GACAACTTCGTGGAAGTGGGGAGGGGAACTGGTGTGTCCATGGCGGGTGC
ATTGGTATAGCGGGCGGAGTTCCGCTACATTTTATCCCTTCCTTCCTTCC
ATCCTATCGATACCTTTTACATTCTTGACTTGTATTCTAGCTATCTCCTC
CTTTCTTTTATTATTTCTACTTCTCCATCTAGTTTTAGTATTTACTATCT
TTCTGTCTGTCGCGATTCGGGGCATTGGGGGTTTCCTTTTTTTCTTTTTC
CTTTCCTTCCGTCACTGTAGCACGCAGGAGAAGGCAGGGGCCGCCTGGAT
GGCCATGGGCTTTTCTTTTTCTTATTTATTCCCTTGACGAGGTTATGCTT
TATGCATGTTATGCTATCGATTGATTGAATGTTATGGGAATTATCATCAT
GTCCGGAATAAGCGAATTGTGTGTGGGGTTTTTTTCTTTGATTGATTTGA
TTGATTGTTTACTTGTGATGCTAGGTGTTTTCGGGGTATGTGTATGGTAC
CGGTGGGGTTTGTATTTTTTTTTTATTTGGGAGGGGGGGGCAGTTAGGGG
CGAACAGGATTGAATTGATTGAATTGATGTGATTGAA

Sequences in the Contig:

SY0AAA10YD15FM1 SY0AAA10YG21FM1 SY0AAA10YL23FM1
SY0AAA11YI24FM1 SY0AAA12YD12FM1 SY0AAA12YP03FM1
SY0AAA13YJ18FM1 SY0AAA14YI05FM1 SY0AAA15YH01FM1
SY0AAA16YA21FM1 SY0AAA16YC22FM1 SY0AAA16YI16FM1
SY0AAA1YC18FM1 SY0AAA1YF14FM1 SY0AAA1YM07FM1
SY0AAA20YG20FM1 SY0AAA20YP22RM1 SY0AAA21YA18FM1
SY0AAA21YF05FM1 SY0AAA21YK22FM1 SY0AAA21YK24FM1
SY0AAA21YK24RM1 SY0AAA22YK22FM1 SY0AAA23YA02FM1
SY0AAA23YB05FM1 SY0AAA23YL05FM1 SY0AAA24YE21FM1
SY0AAA24YE21FM2 SY0AAA24YM14RM1 SY0AAA24YN14FM1
SY0AAA24YN14FM2 SY0AAA26YL03FM1 SY0AAA27YL04FM1
SY0AAA28YG18FM1 SY0AAA28YM12FM1 SY0AAA29YM23FM1
SY0AAA2YC19FM1 SY0AAA30YM01RM1 SY0AAA30YN16FM1
SY0AAA32YG20FM1 SY0AAA32YM09FM1 SY0AAA33YD19FM1
SY0AAA33YO10FM1 SY0AAA34YG05FM1 SY0AAA34YM14FM1
SY0AAA34YM22FM1 SY0AAA35YL09FM1 SY0AAA35YL18FM1
SY0AAA36YF24FM1 SY0AAA36YI05FM1 SY0AAA36YI12FM1
SY0AAA37YE18FM1 SY0AAA38YE11FM1 SY0AAA40YO09FM1
SY0AAA41YC17FM1 SY0AAA41YF01FM1 SY0AAA41YM10FM1
SY0AAA41YN14FM1 SY0AAA41YN19FM1 SY0AAA41YN21FM1
SY0AAA41YO05FM1 SY0AAA42YK11FM1 SY0AAA43YA20FM1
SY0AAA43YD10FM1 SY0AAA43YD19FM1 SY0AAA43YG17FM1
SY0AAA44YI15FM1 SY0AAA44YK07FM1 SY0AAA45YD09FM1
SY0AAA45YI11FM1 SY0AAA45YL05FM1 SY0AAA45YP16FM1
SY0AAA46YA16FM1 SY0AAA46YF01FM1 SY0AAA47YF10FM1
SY0AAA47YG23FM1 SY0AAA48YA18FM1 SY0AAA48YE02FM1
SY0AAA48YK16FM1 SY0AAA49YD10FM1 SY0AAA49YE03FM1
SY0AAA49YE10FM1 SY0AAA49YH05FM1 SY0AAA49YM03FM1
SY0AAA49YN08FM1 SY0AAA49YO23FM1 SY0AAA4YC20FM1
SY0AAA4YO02FM1 SY0AAA50YB09FM1 SY0AAA50YC19FM1
SY0AAA50YK14FM1 SY0AAA52YK09FM1 SY0AAA52YL15FM1
SY0AAA52YM16FM1 SY0AAA53YA08FM1 SY0AAA53YI20FM1
SY0AAA53YO24FM1 SY0AAA54YD10FM1 SY0AAA54YI18FM1
SY0AAA55YH05FM1 SY0AAA55YL14FM1 SY0AAA56YJ07FM1
SY0AAA57YD19FM1 SY0AAA57YI19FM1 SY0AAA58YD24FM1
SY0AAA59YI23FM1 SY0AAA5YM17FM1 SY0AAA60YH01FM1
SY0AAA60YL10FM1 SY0AAA61YC12FM1 SY0AAA61YL08FM1
SY0AAA61YL10FM1 SY0AAA62YM21FM1 SY0AAA63YB11FM1
SY0AAA63YK15FM1 SY0AAA63YM01FM1 SY0AAA6YE20FM1
SY0AAA6YI03FM1 SY0AAA6YJ24FM1 SY0AAA6YM11FM1
SY0AAA7YC22FM1 SY0AAA7YK18FM1 SY0AAA7YN16FM1
SY0AAA8YH20FM1 SY0AAA9YG20FM1 SY0AAB10YG18FM1
SY0AAB12YH06FM1 SY0AAB12YN03FM1 SY0AAB13YE09FM1
SY0AAB13YG08FM1 SY0AAB13YH22FM1 SY0AAB14YF08FM1
SY0AAB15YL11FM1 SY0AAB16YC13FM1 SY0AAB17YA06FM1
SY0AAB17YE24FM1 SY0AAB17YJ04FM1 SY0AAB19YC17FM1
SY0AAB1YF03FM1 SY0AAB1YF18FM1 SY0AAB20YN08FM1
SY0AAB21YN15FM1 SY0AAB22YP12FM1 SY0AAB23YN17FM1
SY0AAB24YB10FM1 SY0AAB26YC04FM1 SY0AAB28YA13FM1
SY0AAB28YF02FM1 SY0AAB28YJ09FM1 SY0AAB2YA16FM1
SY0AAB2YO16FM1 SY0AAB30YB03FM1 SY0AAB30YD05FM1
SY0AAB30YN09FM1 SY0AAB31YH01FM1 SY0AAB31YI04FM1
SY0AAB32YH09FM1 SY0AAB32YK12FM1 SY0AAB33YC24FM1
SY0AAB34YI23FM1 SY0AAB34YP20FM1 SY0AAB35YD11FM1
SY0AAB35YH20FM1 SY0AAB35YM19FM1 SY0AAB36YB14FM1
SY0AAB36YE17FM1 SY0AAB36YJ09FM1 SY0AAB36YK10FM1
SY0AAB36YK21FM1 SY0AAB36YM04FM1 SY0AAB37YH06FM1
SY0AAB37YH12FM1 SY0AAB37YP11FM1 SY0AAB39YH17FM1
SY0AAB39YO18FM1 SY0AAB40YF19FM1 SY0AAB41YG06FM1
SY0AAB41YH05FM1 SY0AAB41YJ08FM1 SY0AAB43YF20FM1
SY0AAB44YB17FM1 SY0AAB44YB22FM1 SY0AAB44YL10FM1
SY0AAB46YM19FM1 SY0AAB47YB18FM1 SY0AAB47YI01FM1
SY0AAB48YC04FM1 SY0AAB48YI10FM1 SY0AAB48YO02FM1
SY0AAB49YE05FM1 SY0AAB4YI12FM1 SY0AAB4YL13FM1
SY0AAB4YM04FM1 SY0AAB51YL06FM1 SY0AAB52YG06FM1
SY0AAB54YB11FM1 SY0AAB54YM03FM1 SY0AAB55YA03FM1
SY0AAB55YB15FM1 SY0AAB55YD10FM1 SY0AAB55YH08FM1
SY0AAB56YE15FM1 SY0AAB58YK06FM1 SY0AAB59YA17FM1
SY0AAB5YI02FM1 SY0AAB5YL20FM1 SY0AAB61YI18FM1
SY0AAB7YC20FM1 SY0AAB8YN05FM1 SY0AAB9YH06FM1