Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1783
Length(NT) : 819
Best Gene Model Blast : Link to GSTUMT00005379001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001587889.1| Score: 993 E_value: 1e-106
KEGG Definition: hypothetical protein
Accession: ncr:NCU10066.1 Score: 942 E_value: 1e-100
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0292 Score: 689 E_value: 3e-73
PFAM Definition: Coatomer_WDAD, Coatomer WD associated region..
Pfam Number: pfam04053 Score: 353 E_value: 2e-34
Swissprot: Q96WV5|COPA_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus
GO:0006886 = Biological process: intracellular protein transport

Sequence:
>Contig1783
TTGGGTCAGGGTAACCACCAGGTCGTCGAGATGGCCTACCAGAAACTCCG
GAACTTTGACAAACTTTCGTTCCTATATCTTGTCACTGGAGACACAGAGA
AGCTCAACAGAATGGCAAAGATCGCCGAGCACCGCAATGACTATACTGCC
AGATTCCAAAATGCTATCTATCTCGGGGATGTGGAGACTAGGATCCAAAT
GCTTAAGGAGATTGATCTATATCCTCTTGCATATGTGACCGCTAAAGCCC
ATGGACTTAACGAGGAATGCGAGGCAATTCTCGAAGCTAGTGGCCTAACA
GAGGAGGATATCAGGATTCCTGAGATTAGCGTACCCATCCCACCCCCCAA
AGCCATAGTTCCCACACATCAAAAGAACTGGCCTCTCCGGGCTGCTTCCC
AGTCATTTTTCGAGAAGGCTTTGTTGGGTCAAGTCGAGTCAATGACGATT
GAGGATGAAGCACCTTCTGGAACGAACGGCTTTGCTATGGATGAAGGTGC
TGTTGATGGCAAAGGGTTCAATGGAGATCTCTTGGATGTGGAGGGAGAAG
AAGATGCCGCAGGATGGGATATGGGAGATGACGATCTCAACCTGGAGCAA
GTCGGTGAACTTGCTGTTGAAACCGACGGTGCTGGTGTTGGTATGAGTGA
GGCAGAGTTATGGGCAAGAAACTCACCAATTGCTGCCGATCATGTGGCAG
CAGGATCATTCGAGACCGCCATGCAGCTTCTAAATCGCCAAGTTGGTGCC
GTAAATTTTGAACCTCTAAAGCCAAGATTTATGGAAATTTACCAAGCTAG
CAAGACCTACCTACCCGCA

Sequences in the Contig:

SY0AAA61YJ07FM1 SY0AAA61YL01FM1 SY0AAB60YI01FM1