Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1782
Length(NT) : 1352
Best Gene Model Blast : Link to GSTUMT00007718001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein CIMG_09222
Accession: ref|XP_001239601.1| Score: 339 E_value: 9e-30
KEGG Definition: hypothetical protein
Accession: ang:An18g02200 Score: 318 E_value: 1e-27
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2765 Score: 621 E_value: 4e-65
PFAM Definition: DUF6, Integral membrane protein DUF6. This family includes many hypothetical membrane proteins of unknown function. Many of the proteins contain two copies of the aligned region..
Pfam Number: pfam00892 Score: 137 E_value: 5e-09
Swissprot: Q03730|YMB8_YEAST
Gene Ontology:
GO:0000329 = Cellular component: membrane of vacuole with cell cycle-correlated morphology

Sequence:
>Contig1782
TTGGGGGGACAACTTTGTACAAAAAAGTTGGATACGGTAATTCTATCCCA
TCGTCGCTTTTCTACAAGGGGCTAAACCTCCAAATCCTGAGATATCGACA
TATCCTCGAGTATACCCGAGTACTTATGATACTGTGGATGGCAAGCCCAC
CCTCCCCATCTTCCGACCGGTACTGTGTCCCGGGAAATTGTATAAATAGA
TCCGTGGGTGAATAAAGTGTGGGTAATTTCCGCCAGTACCCGAGTATCCA
CCGTTTCTACAGCACTTTCTTCCTTCTTTCCTTCTTTTTTCTTTCGCCCT
TGGCCCTTCGCCCAGCGACCGGGTCGGGTCGGGTCGGGTCACCGGGAAAC
GGAGAGGGAGAAGAAGCGGGTGATACAGACCTTGACTCTACAATGTCTAC
ATCTCCACTACCGCCAATTCACGCAAGCTTCTCACCTCCACCGGACTTTA
TCGTGCCACTATTACCCCCGCCACCAGCTCGCCCCAGCTCGCTTCCACTA
ATGCCGAAGCCGCAGCCGATTCGTATCCGTGTTTTCCCCCGCCGCAAAAC
GATTGGCATTCTCCTCCTCGGCGTGGTGATCTTCCTCTGGGTCTTGAGCA
CCTTCCTGACTTTCACCATATTCTCTGACGGGAGTTATACCAAGCCGTAC
TTTGTGACATATGTGAATACGTGCTCGTTCTGCTTCTACCTGCTTCCCGG
GGCGTGGCGGGCGTGGCGGGGGAAGTGCGAGGAGAGGGACCGGAGTAGGG
TGGGATATGCACGTTTGGGGAACGTGCCGTTGCCCAGAGCTGTGGGCGAG
GATGAGGATAGGGATGGGGTGATAATGGCGAGCAAGAGTTTGGTGGTGGA
GGGGGAGGGTATGCTTAGTGAGAGGGAGACTATATTGCTGAGTTTGCAAT
TCTGCCTACTTTGGTTTGTTGCAAACTACTTCCAATCCTACTGCCTCAAA
TGGACTTCTGTCGCCAGTGCTACAATCCTCTCCTCAACCAGCAGTATTTT
CACCCTCATGCTCGGCGCGCTCCTCCGCATCGAGCGCTTCACCTGGACAA
AATTCCTAGCTGTCGTGCTGTCCTTCACCGGTGTATCGCTTGTGTCCTCC
GTAGACCTCAGTCCCTCCTCTTCCCTATCGCCCGGCGCAGGTGATAAAAC
ACCGGGACAAATCCTCCGCGGCGACCTGATGGCCCTTATGGGCGCTTTCT
CCTACGGTGTGTACACAATTCTGTTAAAAGTGCGCATAGGCCACGAAAGC
CGCATCAGCATGACCAGATTCTTTGGCTTCGTGGGGCTGTTCAACTTTCT
CGTGCTCTGGCCCGGTATAATCATACTACATCACGCGGGTGTAGAAAAGT
TC

Sequences in the Contig:

SY0AAA61YK14FM1 SY0AAC19YN06FM1 SY0AAC33YD24FM1
SY0AAD45YG03FM1 SY0AAD62YF03FM1