Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1781
Length(NT) : 710
Best Gene Model Blast : Link to GSTUMT00008061001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein AN7475.2
Accession: ref|XP_680744.1| Score: 128 E_value: 9e-06
KEGG Definition: hypothetical protein
Accession: ani:AN7475.2 Score: 128 E_value: 5e-06
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2897 Score: 153 E_value: 3e-11
PFAM Definition: YL1, YL1 nuclear protein. The proteins in this family are designated YL1. These proteins have been shown to be DNA-binding and may be a transcription factor..
Pfam Number: pfam05764 Score: 222 E_value: 3e-19

Sequence:
>Contig1781
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGACAACAACAACATGGGCA
ACAGTGTCGTGGAATCTCTTGTCGCCGGCAGAGAGAGACGTTCGACAGCG
GGAAACCGACTTGCGTCGCTATTACATCAAGAAGCTGACACCGAGGATAC
CCTCTTCCTCGAAGACGAGGACGATGTCGAATTCGAGGCCAGGGATGTGG
AGGAGCTCTCGGATGTGCTCCTGGAGTCCTCTGACGACGAGGATGAGTAC
AATGGGGGTGGTGGTGTCGACGGAAAAGAGGGCGGACAAGGCGAGGAGGA
TCTCGAGGGCGAGAGGGAACTACAGCAACAAGCAAAGGAGGAGCGAGCAG
CGAAGAAGCGGAAGGCTGCCGAAGCATTCTTGAAACCGAGGGTATCGACG
AGAAAGCGAGTCACAATTCAGGACGGAAGCTCTACTACGACCACGGCTAC
GGCCGCACAAACAACGGCAACGTCCCCATCCCGGGGGTCTCCTCCGAGGC
CTAGAAAGAAGTCGGAGAGGGTTTCATGGATTCCCGAGTTTACAGCTACA
AGGGCCTCAAGCCGAACCCTATCATTACAAAACAGGACGGAAACAATGAA
GAGGCTACAAGAGTCCGAGAAGCGCCGGCTGCATACCATCAAGTTGATGG
AGGCTGCAGCTGCGAAAAAAGATAAAGAGAATCCTCGCAAAGAAATGACG
CAGGTGGAGC

Sequences in the Contig:

SY0AAA28YM14FM1 SY0AAA61YK09FM1 SY0AAA9YB11FM1
SY0AAC49YO13FM1