Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1780
Length(NT) : 1200
Best Gene Model Blast : Link to GSTUMT00007113001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SNOG_04675
Accession: ref|XP_001795088.1| Score: 519 E_value: 1e-50
KEGG Definition: ABR129Cp; K03295 cation efflux system protein, CDF family
Accession: ago:AGOS_ABR129C Score: 480 E_value: 2e-46
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG1483 Score: 540 E_value: 8e-56
PFAM Definition: Cation_efflux, Cation efflux family. Members of this family are integral membrane proteins, that are found to increase tolerance to divalent metal ions such as cadmium, zinc, and cobalt. These proteins are thought to be efflux pumps that remove these ions from cells..
Pfam Number: pfam01545 Score: 326 E_value: 5e-31
Swissprot: P20107|ZRC1_YEAST
Gene Ontology:
GO:0000324 = Cellular component: vacuole, cell cycle-correlated morphology
GO:0005385 = Molecular function: zinc ion transmembrane transporter activity
GO:0006882 = Biological process: cellular zinc ion homeostasis
GO:0006824 = Biological process: cobalt ion transport
GO:0006749 = Biological process: glutathione metabolic process
GO:0006829 = Biological process: zinc ion transport

Sequence:
>Contig1780
TTGGGTCCTCCACACCGAACCATCGTTAAACACCATTCACTTGTTCCGCA
AGGCAATTACTATGAAATACCACTTAAAGCTTTGTTTACCCTAACTTAGG
CCCAACATCTTGTTTCGCCCTAAAGCTTGAGTCGTCACTGCTTCCATCTC
AGCCCTCGGGAATACAGAATTTTCGTCTCCTTTTTCTACTGTGACACCCC
GGCACTTGTCAGCCTCCCTTCCCCTCCCCACTCTTCACCAGAGCTCCCTC
TCTCTCCCGCAACAATAACAACAGCAACAACAGCAACCATGGCATTCTCC
CGCTCAGCAAGGATAATCACCCTGCTGGTGATTGACTCTCTCTTTTTCCT
TTTGGAGATCATCGTTGGATACTCTGTCCATTCCCTTGCGCTTGTTGCCG
ATTCTTTTCATATGCTGAACGACGTTTTTTCGCTGCTGGTGGCGTTATGG
GCGATTAAGCTCGCCAGACAAAAATCCACATCAAGCTATACATACGGATG
GCAACGAGCTGAAGTTCTTGGGGCGTTGATCAATGGTGTATTCTTACTTG
CGCTTTGTCTTTCGATTTTCTTGGAAGCGATTCAGCGCTTTTTTGAGCCG
CAGGAGATATCTACTCCCTGGTTGGTACTCGGCGTTGGGAGTGCTGGCCT
TGCTTCGAACATCCTTGGTTTATTCTTATTTCACGATCACGGTCATTCCC
ATGGCGGCAATTCGCACGAACACGACCTTGAGAGTAGTCTGGTTGGTGAG
GAAAGCGCGGCAGCGGGTCATGAGCACCACAAACACACACGCGGTCTAAG
GGGCCATATTCACGACCCAGCGGAAGATGATCGCGGTGATATCGACGATA
TCCTCCCGGACATTGTTGTCGCAAGGTTATCTCAGCCGATCCCGTCTTCA
TCATCTACCTCGCGAAAGAAGGGGAGAAGATCGACTGATAAATCTCGTCA
ACGCCACTTTGCTTCCCCCGTAACCGACATTCACGTCCACCCCGCCCGCA
ACCGCCAAGAGGTCATTGCCGCAGCGGTCAGTGATACGGAGCACTCCTCA
TCGGCAGTGATTTCATCGGCAGATTCTGACTCCGATGCCCCGACTTCTCG
ATCTCCTCTCCTCTCGGTCACTGGTAAGGGCCGCAAACGAGCATACTCGC
GATCCTGCCACCAAAACCACAATCATGCCAAGCCCAAAGAAAACAAATCC

Sequences in the Contig:

SY0AAA39YB11FM1 SY0AAA61YJ17FM1 SY0AAB24YN12FM1
SY0AAB51YA20FM1 SY0AAC49YL03FM1 SY0AAD18YH14FM1
SY0AAD59YN01FM1