Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig178
Length(NT) : 1234
Best Gene Model Blast : Link to GSTUMT00001751001 E-value : 0.0
Numbers of ESTs : 166

Blast Results:

Nr Definition: glyceraldehyde 3-phosphate dehydrogenase
Accession: gb|AAT76626.1| Score: 1347 E_value: 1e-146
KEGG Definition: G3P_COLGL Glyceraldehyde 3-phosphate dehydrogenase (GAPDH)
Accession: fgr:FG06257.1 Score: 1314 E_value: 1e-143
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG0657 Score: 1046 E_value: 1e-114
PFAM Definition: Gp_dh_C, Glyceraldehyde 3-phosphate dehydrogenase, C-terminal domain. GAPDH is a tetrameric NAD-binding enzyme involved in glycolysis and glyconeogenesis. C-terminal domain is a mixed alpha/antiparallel beta fold..
Pfam Number: pfam02800 Score: 711 E_value: 1e-75
Swissprot: Q9P8C0|G3P_PHANO

Sequence:
>Contig178
TTGGCCAACTTTTTTGTACAAGGGCTTCCCTCACAGCACCCTTCTATTTT
CATCAATACTCCGCTATTTCCCCCCAAACATTTTACTCGCTTTACACTCC
AGGTTCTCAATTCAAAATGGCCGTCCCCATTGGTATTAACGGCTTTGGTC
GCATCGGACGTCTTGTCCTCCGTAATGCCGCCGAACGCGACGACGTCAGG
GTTGTAGCTGTTAACGATCCCTTCATCGATCCTAAATATGCGGTCTACAT
GTTCAAGTACGATTCCGCTCATGGAAATTTTAAGGGAGAGGTTAGCACCA
ACGATGCTGGCGACTTGGTTGTCAATGGAAAGACTATCAGGATGTACTCC
GAGAGGGACCCTGCCAATATCCCATGGGGAGCTGCTGGTGCTGAATACGT
CGTTGAGTCTACTGGTGTTTTTACTACCACCGAAAAGGCGAGCGCTCACT
TGAAGGGCGGTGCCAGGAAGGTTATCATTTCGGCTCCTTCTGCCGACGCT
CCCATGTTCGTTGTTGGTGTAAACTTGGATAAATATAACAAAGACATTAC
TGTTCTCTCCAACGCGTCCTGCACTACCAACTGCCTTGCACCTTTGGCCA
AGGTTTTGAATGACAAATTCGGTATCGTTGAGGGTCTTATGACTACTATC
CATTCCTACACCGCTACCCAGAAGACTGTCGACGGTCCCTCGTCTAAGGA
TTGGCGCGGTGGGCGTACCGCTGCTACCAATATCATACCAAGCAGCACTG
GCGCCGCCAAGGCTGTTGGTAAAGTCATTCCAGAACTCAACGGAAAGCTC
ACCGGAATGGCTATGCGTGTTCCAACTCAGAATGTCTCTGTTGTGGATCT
CACTGCTCGTCTCGAGCGGGGAGCCACTTATGAACAAATCAAGGCTGCCA
TCAGGGAGGCAGCCGAAGGCCCTCTCAACGGGATCCTCGCTTACTCTGAG
GATGAGCTTGTTTCCACTGATCTCAATGGCCACAACGCCTCGTCTATCTT
CGATGCTAAGGCCGGTATCTCTTTGAATGACAACTTTGTCAAGGTTGTTA
GTTGGTACGATAATGAATGGGGCTACTCTCGTCGTGTTTTGGATTTGATC
TGTTATGTCGCCAAGGTTGATAAGCAGTAAATGTGTTACAGTAGGCTGTC
TTTAGGTAGAGGAAGTCTTTTATTTTTCTAATACCAAACAAAATTAGAAC
CAAGGCGATTTCCCCAATCTCCTCTCTTGCTTTC

Sequences in the Contig:

SY0AAA10YI18FM1 SY0AAA11YE18FM1 SY0AAA11YL05FM1
SY0AAA14YI16FM1 SY0AAA14YN13FM1 SY0AAA15YH09FM1
SY0AAA15YI05FM1 SY0AAA15YP21FM1 SY0AAA16YH13FM1
SY0AAA18YP24FM1 SY0AAA19YI05FM1 SY0AAA19YI05RM1
SY0AAA1YM23FM1 SY0AAA20YL11FM1 SY0AAA21YB17FM1
SY0AAA22YD23FM1 SY0AAA22YF22FM1 SY0AAA23YJ04FM1
SY0AAA23YM09FM1 SY0AAA24YK23FM1 SY0AAA24YK23FM2
SY0AAA24YK23RM1 SY0AAA26YJ07RM1 SY0AAA29YM22FM1
SY0AAA2YM07FM1 SY0AAA2YN21FM1 SY0AAA30YF24FM1
SY0AAA30YF24RM1 SY0AAA30YH20FM1 SY0AAA30YH20RM1
SY0AAA33YA03FM1 SY0AAA34YK02FM1 SY0AAA36YB05FM1
SY0AAA36YF16FM1 SY0AAA37YJ17FM1 SY0AAA37YN24FM1
SY0AAA3YF13FM1 SY0AAA40YF23FM1 SY0AAA41YG16FM1
SY0AAA42YA12FM1 SY0AAA42YA13FM1 SY0AAA42YP20FM1
SY0AAA45YN18FM1 SY0AAA46YC23FM1 SY0AAA46YD23FM1
SY0AAA46YF18FM1 SY0AAA46YI19FM1 SY0AAA46YL07FM1
SY0AAA48YO15FM1 SY0AAA49YE12FM1 SY0AAA49YM01FM1
SY0AAA4YC02FM1 SY0AAA4YC08FM1 SY0AAA50YF05FM1
SY0AAA50YN01FM1 SY0AAA52YF12FM1 SY0AAA53YF17FM1
SY0AAA54YM23FM1 SY0AAA54YP21FM1 SY0AAA54YP23FM1
SY0AAA55YE23FM1 SY0AAA55YJ22FM1 SY0AAA56YA01FM1
SY0AAA56YC13FM1 SY0AAA56YL03FM1 SY0AAA58YN22FM1
SY0AAA5YN15FM1 SY0AAA60YA23FM1 SY0AAA60YM13FM1
SY0AAA60YO04FM1 SY0AAA60YO19FM1 SY0AAA61YO04FM1
SY0AAA63YB09FM1 SY0AAA63YK11FM1 SY0AAA6YE16FM1
SY0AAA8YA15FM1 SY0AAA8YD17FM1 SY0AAB14YO01FM1
SY0AAB17YH17FM1 SY0AAB17YH23FM1 SY0AAB17YL11FM1
SY0AAB19YF01FM1 SY0AAB19YJ19FM1 SY0AAB20YH03FM1
SY0AAB20YJ11FM1 SY0AAB20YJ15FM1 SY0AAB22YG19FM1
SY0AAB22YH17FM1 SY0AAB22YK04FM1 SY0AAB23YD21FM1
SY0AAB25YH10FM1 SY0AAB25YI13FM1 SY0AAB26YM05FM1
SY0AAB27YG07FM1 SY0AAB28YE19FM1 SY0AAB29YB18FM1
SY0AAB32YB18FM1 SY0AAB32YL11FM1 SY0AAB33YH06FM1
SY0AAB33YP16FM1 SY0AAB34YE16FM1 SY0AAB35YA09FM1
SY0AAB35YE07FM1 SY0AAB37YJ15FM1 SY0AAB37YJ22FM1
SY0AAB38YI12FM1 SY0AAB38YJ04FM1 SY0AAB38YL24FM1
SY0AAB39YL20FM1 SY0AAB3YL01FM1 SY0AAB41YN19FM1
SY0AAB43YJ02FM1 SY0AAB46YP04FM1 SY0AAB47YE06FM1
SY0AAB48YB01FM1 SY0AAB48YE22FM1 SY0AAB49YF22FM1
SY0AAB49YK12FM1 SY0AAB4YI22FM1 SY0AAB50YC16FM1
SY0AAB50YM04FM1 SY0AAB51YF04FM1 SY0AAB51YI05FM1
SY0AAB51YK03FM1 SY0AAB52YA05FM1 SY0AAB52YI09FM1
SY0AAB53YE21FM1 SY0AAB53YP18FM1 SY0AAB54YH03FM1
SY0AAB54YI21FM1 SY0AAB55YB16FM1 SY0AAB55YK03FM1
SY0AAB56YE06FM1 SY0AAB56YL19FM1 SY0AAB56YP18FM1
SY0AAB57YF10FM1 SY0AAB57YM03FM1 SY0AAB58YG13FM1
SY0AAB59YC03FM1 SY0AAB59YC17FM1 SY0AAB59YH03FM1
SY0AAB59YP17FM1 SY0AAB5YI06FM1 SY0AAB60YF16FM1
SY0AAB60YI20FM1 SY0AAB61YJ22FM1 SY0AAB61YO13FM1
SY0AAB7YD20FM1 SY0AAB7YI24FM1 SY0AAB9YG06FM1
SY0AAB9YL23FM1 SY0AAC10YH12FM1 SY0AAC14YP24FM1
SY0AAC31YL24FM1 SY0AAC42YB06FM1 SY0AAC46YJ23FM1
SY0AAC47YD02FM1 SY0AAC53YI14FM1 SY0AAC59YN13FM1
SY0AAC62YC15FM1 SY0AAC8YC08FM1 SY0AAD17YI14FM1
SY0AAD3YP21FM1 SY0AAD45YA01FM1 SY0AAD4YF11FM1
SY0AAD61YA07FM1