Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1779
Length(NT) : 1641
Best Gene Model Blast : Link to GSTUMT00000111001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001215952.1| Score: 753 E_value: 1e-77
KEGG Definition: hypothetical protein
Accession: ang:An02g14490 Score: 751 E_value: 9e-78
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P38140|YB89_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig1779
TTGGCAGCTACGCATACTCACCGAGCATGGGGACCGGCGAAGGGTATGGA
GGTTTCTCGGCTCCGCAAGATGACCCGCCGCACTATCGCGATAGCTGGGG
CAGCGGTCATGGGGGGCGGAATTCCGGGGCGGGTCACAGTGTCGGGTTTG
CGGGGACCTACATGATTGAAGCCGGGCCGGGGAGTCTCACCAGCCCATCC
CCACCGGTGGAGTCCCCGCGACAGAATTACATTCAAAATACCGCGCAGAC
AACAGCTGGCTCATCGAGTTACGATACAACGGCGACTAGTGGTCCTATGA
GTTCTCCATCGTTCTACCAATCGGGTGGGCACCATCGCCCTTCCACCCTC
CAGCAGGTGCAATCTGCATCCACAGCCCAACAGCAGCAACAGCAACAAGT
CCCACAAGTCCAAGCCCCCATGCGCCGTCGCAGACTCCCGGAGGACCCCA
GCCAGATCTACAGCTCCATCACAACACCATACCCATACACACTCCACTAT
CACCGCCTCTTCCACATGCTCGAAACCCGTTTCCCCAAACCTCTCCTTCT
ACGCATCGCTCGGGCAATGGCCTCGTTTCGCCCTTCCTTCATCGCCTGCA
CACAGACGCTCAAAGCCGACGACCTCCTCTTCATGGAAAAGTGCTTCCAG
CGAACACTCTGGGAATATGAACGCTTCATACAAAACTGTGGCACACCAAC
TCTCGTCTGCCGACGCACAGGGGAGGTAGTCGGCGTCGGCAAGGAATTCT
GCATGCTTACGGGCTGGGAGAAGCAAGTTCTCCTCGGCGAAAAGGCTAAC
CGAAACACGAATGTGCCCGTCAACGGTGAAGTCGTTAACTTTCCGCCGCC
GTCTGTCGACGAGTATGGTCATGGTGGCGTTGGTGTCGCTGCCAGCGGTG
GCGGTGGGGGAGTTAGCGGCGGCCTTGGGGGAGTGAAGAAACCCGTATTC
CTGGCCGAGCTCCTCGACGACGAGAGTGTTGTTGAGTTTTATGAGCAGTT
TGCCCGATTGGCCTTTGGCGACTCGCGTGGGGCTGTCATGACAACTTGTA
AAGTGCTCAAGTATCGCGCTGAGAAGGACGACAGTAAGAAGGATGGCGTG
AGGGAGGCCCGTGGCATGGATGGCCTCGGGGCGAAGGACGGGAAGGTTGA
GTGTGCTTTTTGTTGGACCATTAAGAGAGATGTCTTTGATATTCCGATGT
TGATTGTTGCGAATTTCCTACCGATTCTTCCGAGACCGGCGCCTGAGGGG
GGGAAGTAATTTTGTTTTCTTACTTTTCCTTTCTCTTTTCCTTCTCTTTT
TGATGGAGCCGGGTGTGGTAGTGCTGTGTGTACGATTCTGTGTGTTTTTG
TTTTACCGCTCTGATTGTGTACGCTTCGTCAGCTACCTATTTGTTTTATT
CCCAGAAGTGGCAGGATGGAATGGGAGCAGTACACGTTTTGTATTTCTCC
CCTCCCACCCCCTTCGACTATCGCTTTATTTTCAATTTTGGCTTTTCATC
CCTTGTACTTGGACTACAGTGCGCAGCTATAGACTCCTGAGAATCTTTTT
CCTTTTCACTCTCTCGTTTTATAACATTTTGGTCTTTGTGGTTAGTTAGT
TAAGGTTAACTTCAATTTCTGGTTCGCGACTTGGGTCGTGG

Sequences in the Contig:

SY0AAA61YJ04FM1 SY0AAB46YL05FM1 SY0AAB4YF04FM1
SY0AAB61YN08FM1 SY0AAC10YM24FM1 SY0AAD20YC04FM1