Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1778
Length(NT) : 803
Best Gene Model Blast : Link to GSTUMT00008802001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1778
TTGGACTGTTTTTATTGTAACTGTTCTCATCCTCGCAACTACCAACGACC
TCACCACTAGTATCCCCACTACCACCCCCGACAAACCTAGCATATCATCC
TTATTCATCAAAGTTCTGAAACCTATTGTCACCTACAACCGGTATTACGG
AGAGCTCAGATGGCACTAGCACAAGCATGGTCACCCAGTGCTCGTTCACT
TGAGAGCGTTTATAAGGTTCTAAGTGGCCACGATCACCCATTTATCATGG
TTGGAGCATATGCACTTCCATGGATGGGAGTTTCATTGCATACAGGCTAT
ATAATGGATATCCTGGTAAGAACCTCACAAACGGAATCTATACGCCAGGC
ATTAGCCCAAACAGGGGAATGGATGGATGTCGACAACGCCAGCATTCCAG
GGCTAGTTTCATTGGCGGAACGCCGGGAGCAACGCTCCGTCGGTCGATTG
AAGAGACTCGATGATCACTGGTATATTAGCCTGTGCACGGAGGACACCTA
CAAGCTCATGGTCGACACCAAGAAAATCCAAGTGCCGCATCCCATCAGCT
TGAATGCTGGGTTGGTGGAGTCTGAATTTCATCCCAATCCCACAGATCGC
CGAGTCAGGCCCTTTCTTATTACCGACAAAAACATCAGATTCGTGTGGGC
TGAGCCAATCACCTTTCCCGTTTTTATACCAACCATTCCCGAATATCTAG
ACTCTTGCCTTAGCTGTACAGGAGGGCGGAGCTATTTGGATGATGAATCA
TGTAGGGTTCCTGAATCCGACCTGGGATATTTGTCAAGATATCTCGCCCT
CGA

Sequences in the Contig:

SY0AAA61YI23FM1 SY0AAB39YE02FM1 SY0AAC10YL15FM1
SY0AAC34YB21FM1 SY0AAC57YH04FM1 SY0AAD2YN11FM1
SY0AAD5YB13FM1