Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1777
Length(NT) : 791
Best Gene Model Blast : Link to GSTUMT00000177001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1777
TTGGCTATTCCCCCCATCAACTCCTCCTGGCCGCTTCGTCAACATGGCTA
ACCCTGGAACGACCGCTGCTATCAACCAATCACCGGGGTCTCCTACGCTC
TCTAGTGGTTGGGAAATTATCGAGGAACAACGAACTTTTTACGATGAGCA
AGATTGCCTGCACCTAGGCCGTAGCCTCACGAGTGACAGATTGGGGGATA
GAGAGGAAAATGAAGTCGTGATTTTTGAGTATTCTCTGGACCCGGATTTT
CTGGACCCAGAGGATGAGAGTTCTGGGGATGAGGAGGACGAGTCTCCCTC
TGGAGACTATGATGTATTCTATCGAGTGCCCAAGGATAGGCTAGTGGGGT
CCGGACAATTTGACCAAATAATCAACCCTACCAGAGATCCTCGCCCGATT
ATATCACCGCCACCGGGACAACGGTTGGGCATTATAGATTTTCCCCAGTG
TTATGATACAAGCGATGGTGGCTTATTAGGCGCGGTGGCGGAAAAACTCG
GCCTCCCAGGTGGAACAAATTTCGGGGAGACACATTGGGCAAGAGTTCGA
GCACTGCCTGGTCATGGAGCCTTTAGAACCGGTATTTCATTATGGGTACC
TTCCAGGGAGGCGTCGCAGCCCGGGGGTAAGCTCGCCCTTTTCGCGTCGC
TCCCATATTTTGGGAGGTCTAGCGACGGGGCCCAATTGGGCCCTGATGAC
GAGAGCGTTGGACTCTTAGATTTCAAGCGCCTGGGAGTTGGTCTTGCTTC
CGGGGCCATGGAAAGAGATGATATAGGAGAAATATTAGTGC

Sequences in the Contig:

SY0AAA15YJ08FM1 SY0AAA43YL08FM1 SY0AAA5YG14FM1
SY0AAA61YI14FM1 SY0AAB49YF24FM1