Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1776
Length(NT) : 1674
Best Gene Model Blast : Link to GSTUMT00010999001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: C6 zinc finger domain protein
Accession: ref|XP_001269957.1| Score: 216 E_value: 2e-15
KEGG Definition: C6 finger domain protein, putative
Accession: afm:AFUA_1G01850 Score: 211 E_value: 4e-15
KOG Definition:
Classification: [Transcription].
Kog Number: KOG4274 Score: 127 E_value: 1e-07
PFAM Definition: Zn_clus, Fungal Zn(2)-Cys(6) binuclear cluster domain..
Pfam Number: pfam00172 Score: 136 E_value: 9e-09
Swissprot: P39001|UME6_YEAST
Gene Ontology:
GO:0000508 = Cellular component: Rpd3L complex
GO:0003677 = Molecular function: DNA binding
GO:0030528 = Molecular function: transcription regulator activity
GO:0016575 = Biological process: histone deacetylation
GO:0007131 = Biological process: meiotic recombination
GO:0007068 = Biological process: negative regulation of transcription, mitotic
GO:0045836 = Biological process: positive regulation of meiosis
GO:0042493 = Biological process: response to drug
GO:0030437 = Biological process: ascospore formation

Sequence:
>Contig1776
TTGGCCTCAAACGAGTAAAGCGAGGAGCTTTTCCCTCTCTACTCTCACCT
CTCGCCAACCCCCCCTCCCCCACTCTAACCCTTTTCTCCGTTTTTTTCTT
TTCCAAAAATTAATTTTGTTCCTCATTGCGGCTGTTTGCTGGCCCGGATC
TGATCAGATCAGATATACCCTCGGCTCATTTGAACATAGCGTTTGCATAC
GGTTTCTCTCACTCTTCATTTTTTCCCCCACTGCCGTTGTCGATTGTGCT
GGTTTGGTTGTCCAGGTGGATTGCCACCTCCTTCGCCGCCATCGACTAGA
CATTATTCAGCCCGCCCGCTCCCCGCCGCTCATCCTTTCAGCCATCCTCC
TGTTCACTCTTTATTCTCCATCTCAACCAAGGGCCCCACTCCAGCGCACT
TGCCGTTTGAGTTTCAGCCTCAAGGCGTCCAACATCCAACAACTCACAAG
CCTAATTCTCTTTCTTCTCCCACTACTCCTCATTTTTACCAACAACTTCA
GCGATATTCTCCTAAGTGGGGCGAGCCGCTATTCAAGGGTGGTCGCGTCG
TCGTCGACTCATAAAACCAACCTCTTCTGTCGCCACGGCAGGTTGACTGA
GACCCTCACCCCCGAGAGAAAAGTTACAGACCAAATGCCCCGTGCCCCAG
TCGCTGGTCGTGAGATACGCCGTCGGAGCCGGAACGGTTGCTGGAACTGC
AAAGCCAGGAAGGTAAAATGCGGTGAAGAGAAGCCCCGCTGCAGCAACTG
CGAGCGACTCGACGAAGAATGCGATTACAAGATTAGGTTATCGTGGGGAG
GCCGCCCTCTGAAGAAGAAGCAGTTAGAGAATGGGGCAAATGGACAGGAC
CCTAATGCCGACGATCAGTCACAGTTTATCCCTGGGGCCGGTCAGTTCTC
AATAAACCAGCACTTTCCTTCCCCGCAGACCTTTGTGCAGACTACGCCTA
GTAATGGAGCGAGGAAACCACCGGTTCCGAGGGTTGGGAATGGGAAGAGG
ACTACTATGTCGAATTATCAGACTGTGTTTTCTGTAGCGGAACCTTCGAG
TGCCCCAGTGATGCCGGTTTCATCGGCACCTCTAGACCCACAATTGGCTT
CGGTCACTACACAACAGCCTCCGCCGCTACAAAGTCCTGCTACCATCCAG
CAGCAGCAGCAGCAGCACCAGAATCGGTCAAGTGCTTATGGATGGCAGCC
AGGACTTACCCCAACTACCACAACACCTCCCTCTAGAACTTTTGAGAATG
ACGTAGTATTCAAGACAGAACAGCAGCAACAGCAGGGCCTTTTCTCCCCC
TATACACCAGTCTCACAATCATTTAACCAGGTTGCATCACCCGTTTCTAG
TTACCCGAATAGCAACGGTCAGATTCATAGCCCCCCGGGGCCTCCCAGCC
TTGTCACGAGTCCTACAGCTCAGTATGACAGCCAGCAACACAGCTCTCCA
ACACAGCAATATCACAGCAAGTCGTTTCATACACCCCCTCCAATCCTTAC
ATCGCCGACGAAGAGACTACGAACTAGCACTTCTCCTATACAAACATCTC
CTCATTCCCCATATACGTTTGAGCATATCAACGCTCGTCCAACCGCTACT
GTGGCACCAATCCCTACTTCTCTTGGCACAGCTTTGGATTATATATCAAC
ACCAATATCCAATGCCCCAATAAA

Sequences in the Contig:

SY0AAA24YH01FM1 SY0AAA24YH01FM2 SY0AAA42YE15FM1
SY0AAA52YJ21FM1 SY0AAA61YI10FM1