Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1775
Length(NT) : 1439
Best Gene Model Blast : Link to GSTUMT00004828001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_09615
Accession: ref|XP_001552003.1| Score: 1423 E_value: 1e-155
KEGG Definition: hypothetical protein
Accession: ncr:NCU00536.1 Score: 1416 E_value: 1e-155
KOG Definition: No Hit Found
PFAM Definition: Abhydrolase_1, alpha/beta hydrolase fold. This catalytic domain is found in a very wide range of enzymes..
Pfam Number: pfam00561 Score: 213 E_value: 8e-18
Swissprot: Q10341|YBLH_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0016413 = Molecular function: O-acetyltransferase activity
GO:0019344 = Biological process: cysteine biosynthetic process

Sequence:
>Contig1775
TTGGCCAACCTCCACCGAATCATATCGTGTTCCCAAGGACACACAGAGCG
AAGGGAAAATAATAATAATAATTCCCGAGACAAGATCCATCCTCATCCTG
AGACTCCCATATCGCAGATACTGTAAGAGGGAGCACCCCTGTTGACCTCG
TAATTCCTAACAGACAAACATGCGATCTCAGTTCTCAAAATTGCTTCGCC
ATGCGGTGCAGCCTCGCCGTATATACATCAATTCCGTTCCCGGTGCGATG
AGGTTACGGAAATGTACCCCGTCGCCATCAGCAGACCCATGGCCACCACT
CCGGGGCTTTAGCGCTTCCCCCTCCTGGCCTTCCGGGTCCGCAGCGTCGA
ACCCACAAATGTCCTTCCCATGCCTAGACGCTGTAGAGTCAAGGACCCAA
GAGATTGTGTCCCGGTCCATGACTAATGGTCCTGAGCCTTCTTACACGAC
CGGTGTTCACAAGAAGTTCACGTCAAAGGACCCGCTCTTGCTAGACTATG
GCGGGAGACTGAAGGAGTTCACCATAGCCTATGAAACCTGGGGCAATATG
AATGCGGACCGGTCCAACGTAGTGCTCCTCCACACTGGTCTCTCCGCATC
CTCCCATGCAAAGTCCAACGAGGACAACCCACGCCCTGGCTGGTGGGAGA
AGTTCATAGGTCCTGGCTTGGCACTCGATACGAACCACTTTCATGTGATA
TGCACGAACGTGCTCGGGGGCTGTTACGGATCCACAGGACCGGCCAGCAT
CGATCCCGCGGACGGGAAGCGGTACGCCACGCGATTCCCCATCCTGACTA
TGAGTGACATGGTCAGGGCTCAGTTTCGCTTGCTGGACGCACTCGGCGTG
GACAAGCTCATGGCAAGTGTCGGAGCCAGTATGGGCGGCATGCAGAGTCT
TGCCGCCGGGGTCTTATACCCCGATAGAATCGGCAGGATCGTGAGCATAA
GTGGTTGTGCCCGAAGCCATCCCTACAGCATTGCATTGAGACATGCTCAG
AGACAAGTCCTGATGGCCGACACAAACTGGAACCGCGGCTTCTACTACGG
CAAGGTCCCACCGCACCTGGGCATGAAGCTAGCCCGGCAGATCGCCACAG
TAACCTACCGCTCGGGTCCCGAATGGGAACAACGCTTCGGCCGGCAGCGC
GCAGATCCCTCCCGCCCCCCCGCTTTATGTCCTGACTTCCTGATAGAAAC
CTACCTAGACCACGCTGGCGAGAAGTTCTGCCTAGAATATGACGCCAACA
GTCTCCTCTACGTGTCGAAGGCAATGGACCTCTTCGACCTGGGCATCGCG
AACCAGGATAGCATCCGCGAGTTGCGCCAGAAGAGCAAGCACAAACTCCT
CGAGGGCTATTCCAGCGACAGTGAGCACGGCGGCGGTGAGAATGAGGGCT
GCTCCTTGGCCTTGCCCAGGGCACCGTACACCGAGCAGC

Sequences in the Contig:

SY0AAA48YD03FM1 SY0AAA61YI07FM1 SY0AAC56YL04FM1