Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1774
Length(NT) : 1865
Best Gene Model Blast : Link to GSTUMT00007293001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: hypothetical protein MGG_14264
Accession: ref|XP_001403132.1| Score: 829 E_value: 1e-130
KEGG Definition: hypothetical protein [EC:1.1.2.3]; K00101 L-lactate dehydrogenase (cytochrome)
Accession: mgr:MGG_14264 Score: 829 E_value: 1e-130
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0538 Score: 636 E_value: 1e-66
PFAM Definition: FMN_dh, FMN-dependent dehydrogenase..
Pfam Number: pfam01070 Score: 618 E_value: 1e-64
Swissprot: P09437|CYB2_HANAN
Gene Ontology:
GO:0005758 = Cellular component: mitochondrial intermembrane space
GO:0004460 = Molecular function: L-lactate dehydrogenase (cytochrome) activity

Sequence:
>Contig1774
TTGGCCGGTACGCGCATGCTGTACTGTATACCATACACTCGCTACAAGCT
ACCACAGTCGAATCTTAGCACTGTGCCGGTGGTGATCCTGGCCCACTGCA
CAAGCTGATCGGTTGGGGCTGCGCTGTGCTGTACGGCACTTGTCGGTATT
AGGGCGCTCCGCAAATGTATAACAGGGCATCCTTTTAAATAGCTAGGCTG
CCCCCCCCCGGGCCCTTATGATATGTCGGTGGGCAATTTGAAAGCAATGT
ATACTCTCAAAGATGTGGCTGTTCATGAGAATCCCGGGGATTGCTGGATA
CTGATCAAAGGCAGGGTTTACGATGTAACCGAATTCTTACCACAGCACCC
TGGTGGGGCAGAAATAATTCTTTCCTATGCTGGAGCCGATGCTACGGGTG
CTTATGAAAGTGTTCACACGTCCTCCCTCCTCGAGACCCCGCCACCAGGG
TTCAGGCTCCTCGGTCCCCTATCCCCCTCGGAATTACCACCAGTCTCGCG
GAATCCCGGATTGGATGTCGAACTGCACGCGAAGCCCCCTCTCGATACAA
TCATCAATACTTTTGATTTTGAGGCTGTAGCAGAGCGTACGGTCACCCCT
AAAACATGGGCTTTTTACTCCTCCGCTGCTACGGATCTACTTTCAATGAA
ACTGAACAGGAGGGCTTTTGATCGGGTTTTGTTCAGGCCGAGGCTTATGC
GCAACGTCAAGTCCGTAGATACTAGGACGAAAATTCTAGGTTTCAGCACT
GGCGTCCCATTCTTTATAGCGCCGACGGCGATGCAGGGAATGATTAACCC
GGATGGAGAAAAGGCTGTAGCGATGGGGGCGGGGGAGGAAAAGGTCATAC
ATATAATATCAACCAACTCCTCACATCCAATTTCGGACATTGTTTCTTCT
GGAAAGGGTCCCGAGCAACAAACCCACTTTCTACAGCTATACGTCAACAC
CGATCGTCAGAAAACTGCTCAGCTCCTTGCTAACGCAAAATCCTGCGGTC
TCAAAGCTGTCTTTGTAACTGTTGATGCCCACATTTCCGGGAAGCGCGAG
GCAGATGAGCGTCTGAAGGTCGACGTCCCAGTAAGGTCCGCTGTCAGCGG
TGCTATATCGCATAATGACAAGAAAGGGGGAGGTATGGGGCGTTTGATGG
GGTTATATATTGACCGGACCCTTAATTGGGAGGATATCCCTTGGATAAAA
AGCGTAGCCGGGGGTCTTCCCATCGTTTTGAAGGGTATTCAGACAGCTGC
GGATGCAAGACTAGCCGCTGAATATGGGGTCCAGGGAATCGTCTTGTCAA
ATCACGGTGGGAGGAACTTGGACACGTATGCATCCACGTACCATGACGAC
CGGCGATAATATCTAATTTATCAGATCACCACCCGCCCTGTATACGCTTC
TCGAGATCCACAAGGTTTGTCCAGAAATCTTCAATTCTCTGGAGGTATAC
ATAGACGGGGGAATTCGAAGGGGGACGGACATATTTAAGGCACTATGTCT
TGGTGCTACGGCGGTAGGGGTCGGCAGACCCTACTTGTATGCTCTCAATT
ACGGGGCAGAAGGCGTCGCACATCTAACCCAGATCCTCAAAGACGAACTC
GAAACAACAATGAGGATGTGTGGCGTTACGGACCTATCAGGAGTCCATCC
AGGACTGGTAAACACAAGGGAAATTGACGCATTGGTTGAGGATGGGATCG
AGCATTCATATGTGAAGTGGAGGCCAAAGAGTAAAATATAAGTTACGGTG
GGACAATTTTATATAGAATAGCTAGGCGCTCATGTCATTGGAATATTTGC
TCGGTGTACTGGTACTAAGGAACCATATCCATCAAACCCCGTGGTGGGAA
AGCCCTAAAAAAAAA

Sequences in the Contig:

SY0AAA22YE17FM1 SY0AAA25YF12FM1 SY0AAA33YM13FM1
SY0AAA42YH23FM1 SY0AAA55YN06FM1 SY0AAA61YH21FM1
SY0AAA63YP11FM1 SY0AAB18YH20FM1 SY0AAB27YK04FM1
SY0AAB33YK04FM1 SY0AAB48YE15FM1 SY0AAB7YL21FM1
SY0AAC50YE24FM1