Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1773
Length(NT) : 1056
Best Gene Model Blast : Link to GSTUMT00006472001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein SS1G_00185
Accession: ref|XP_001598099.1| Score: 470 E_value: 4e-45
KEGG Definition: hypothetical protein
Accession: cal:CaO19.6175 Score: 373 E_value: 4e-34
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG3100 Score: 359 E_value: 7e-35
PFAM Definition: Fcf2, Fcf2 pre-rRNA processing. This is a family of eukaryotic nucleolar proteins that are involved in pre-rRNA processing..
Pfam Number: pfam08698 Score: 346 E_value: 2e-33
Swissprot: Q12035|FCF2_YEAST
Gene Ontology:
GO:0005730 = Cellular component: nucleolus
GO:0000480 = Biological process: endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)
GO:0000447 = Biological process: endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)
GO:0000472 = Biological process: endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)

Sequence:
>Contig1773
TTGGAACTTTCATCTCCCCTCCTTCCCACCCCCCCCCTTCCCCGCAATGC
CAACAGAAGAAACCCCTGGTCTCCATAAGGAATCAGCAGAAGCAGAAGCA
GTGCCAGAAGGAAATAGAATTGACGTGGTCGAGGGCCCACCCGCTCGCTT
GTTTTCCTCATCTCATGTCCGCAGTGACGGTTTTGGAGACGATGTCGCTG
AGCTGTCGGATGAAACAGTCGGCCGCCTGCTCAGCGAGGCGGAGGAAAGA
ATGAAATCCTCGTCTAAAACATTATCAACGTCCTCTAGCACTAATCGCAG
CAAAACCTTGATGACAAAATTCCCAAAGCTCAATCCCGGCGCTTCTTTGC
CAAAGGCACCCATCAAATCCCAAGGCGCAGTTTCTAGAATTTCAGATCCT
TCTCTTCTCGTACCCTCATCTGATCGTAAACTTGCGAACACATCAGCAGC
TGCAGGAGGAGTATCCCTTGTGGATCCAGCGTTATCAAAGAAAAGGCTCA
AAGAGGACGAGAAAACTGCTGGATTGAAGTGGTTTGATATGCCGCGTACC
AACCTGACCCCGGAATTTAAGCGCGACCTGCAGCTGATCAAGATGCGTGG
CGTCCTTGACCCCCACCGCCACTACAAGAAGGACAACTCTTCCTTTCCAG
AATATTCCCAGGTTGGGACCATTGTGGAAGGAAACGCCGACTATTTCTCC
TCGAGGCTTAGAAATAAGGAGAGGAAACGGACGATCGCGGAGGAGGTCAT
GGCTGATGACAGTAGCCGCAAACGATTTAAGAACAAATACGAGGAGATAC
AGCGCAAGAAGAGGAGTGGTAAGAAGGAGTTCTACAAGAAACTCAAACAG
CAACGGAAAAAGTCATCCGTCTAGTTTCGGATCAAATATCGCCCATGAAA
TTGGCCTGGCCTCTGTTAGACTTTACTTTTTTTTCCCCCCCTTTTTTCAA
TTTCTCGGATGTATCAATATGTCAAGGTCATGGGTGTTTCGGTTGGCGTT
TCTTTGTCTTTGGCGTCCCCCAAGTTCCTCGGCTACACAAGACCAACAGG
TTCGGA

Sequences in the Contig:

SY0AAA35YP08FM1 SY0AAA61YH17FM1 SY0AAA62YG18FM1
SY0AAB21YI21FM1 SY0AAC11YI13FM1 SY0AAC56YD17FM1
SY0AAD20YK10FM1 SY0AAD27YG06FM1 SY0AAD50YL07FM1