Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1772
Length(NT) : 879
Best Gene Model Blast : Link to GSTUMT00006171001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_06092
Accession: ref|XP_001555387.1| Score: 556 E_value: 3e-55
KEGG Definition: hypothetical protein
Accession: fgr:FG07481.1 Score: 525 E_value: 6e-52
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2382 Score: 373 E_value: 1e-36
PFAM Definition: Abhydrolase_1, alpha/beta hydrolase fold. This catalytic domain is found in a very wide range of enzymes..
Pfam Number: pfam00561 Score: 158 E_value: 1e-11
Swissprot: O94437|YFI3_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig1772
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCACGGGTAACGGTATTGAAA
CTTCCAAACGAAACCTCTCTACCTCTCAATACCCCCCACCATGATAGCTA
AAATCAACTTTCTAAGGCTCACTCGTTCAGCAGTACATCCGCGTGCCTAC
TCAACCAAGATAGAGCCGGTCCCACTGGCCTATCACCTCCACCCAGCGCC
TGGTCCCCTCGACCGCCAAGAACGATTCCCCATTGATAGTGATGCATGGG
CTTTTCGGCTCGAAGCAGAATAACCACAGCATCAGGCGTTAGCAAGAGAC
TTAAACAGACCAGTTTACACACTCGACCTCAGAAACCACGGCGAAAGTCC
ACACACCCCACAGCACAACTACGAAGCCATGGCAGGGGATGTAGAACACT
TCCTGAAGGAAAATAAACTAGGCCCTAAAACCGCTCTGATCGGCCACTCA
ATGGGCGCCAAAACCGCCATGACCATAGCCCTCCGCAAGCCCTCCATAAT
CTCCTCCATAATCGCCGTCGACAACGCGCCCATCGAGGCGGCCCTTCACT
CCTCCTTTGGCGGGTACGTGCGCGCGATGCGCAAAATCGAGGACTCCCAC
CTCGCGGAGGCGAAAGCGGCAGACGCCATCCTTGCGGAAGTGGAGCCCGA
TATCGCCATCCGCCAGTTCTTGCTGCGCAACCTCGTGCGTGGCGACGGTG
GTCGTCTCAGCTTCCGCATCCCGGTGAGGACGCTGGCAAGGGAGCTGGAT
AACATGGCCACCTTCGCCTACCATCCCGATGAGGTCCGGTTCGAGAAGAG
GGCGCTCTTCGTGCGCGGGACGCGGAGCCCGTATATCCCCGACGAGGCAA
TCCCCGTCATTGGGAGGTTTTTCCCCCTG

Sequences in the Contig:

SY0AAA61YH11FM1 SY0AAB42YJ06FM1 SY0AAB51YP07FM1
SY0AAD19YI02FM1