Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1771
Length(NT) : 556
Best Gene Model Blast : Link to GSTUMT00003052001 E-value : 1e-114
Numbers of ESTs : 2

Blast Results:

Nr Definition: glycyl-tRNA synthetase 1
Accession: ref|XP_001526925.1| Score: 290 E_value: 2e-46
KEGG Definition: CaO19.8067; glycyl-tRNA synthase
Accession: cal:CaO19_8067 Score: 291 E_value: 8e-46
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2298 Score: 329 E_value: 8e-32
PFAM Definition: tRNA-synt_2b, tRNA synthetase class II core domain (G, H, P, S and T). Other tRNA synthetase sub-families are too dissimilar to be included. This domain is the core catalytic domain of tRNA synthetases and includes glycyl, histidyl, prolyl, seryl and threonyl tRNA synthetases..
Pfam Number: pfam00587 Score: 185 E_value: 4e-15
Swissprot: P38088|SYG_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0004820 = Molecular function: glycine-tRNA ligase activity
GO:0006426 = Biological process: glycyl-tRNA aminoacylation
GO:0006353 = Biological process: transcription termination

Sequence:
>Contig1771
TTGGCTCGGCTTAAAGGTGATAAGGAAGCGAGAGGAGAGAGAATTGTGGA
GGAAGGAGAAGACGCCGATAAGAAGAAACGAAAGAAGAAGTTGAAGGATA
TTAAGGCTATCAAGCTTGATGAAAAGGTTATCCAGGAATACGAAGGAGTA
CTTGCAAAGATTAGTGACTGCAGCGGCGAAGAGCTTGGAAAGCTTATTGT
CGACTATGGAATTACGAGTCCTACCACTGGCAATCCGCTTGAGCCGCCAG
TTTCTTTTAATTTGATGTTTCAGACGTCAATTGGCCCCAGCGCAAATCTT
CCAGGGTAATATTTGTTTACATTTGTTTGTGGTTGTGAGTCATATACCTA
ACAATACATAGATACCTCCGTCCAGAAACCGCCCAGGGCCAATTTTTGAC
ATTCAACAAGTTATATGAGTTCAACAACCTGCGCATGCCTTTTGCTTCGG
CCTCGATAGGAAAGTCATTTCGTAACGAGATTTCTCCCCGTTCTGGACTG
CTTCGTGTCCGCGAGTTCCTCATGGCTGAGATCGAGCATTTTGTCGACCC
ACTTGA

Sequences in the Contig:

SY0AAA3YO12FM1 SY0AAA61YH07FM1