Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1770
Length(NT) : 624
Best Gene Model Blast : Link to GSTUMT00004510001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_08079
Accession: ref|XP_001798406.1| Score: 191 E_value: 4e-13
KEGG Definition: hypothetical protein
Accession: ncr:NCU00005.1 Score: 154 E_value: 3e-09
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2417 Score: 107 E_value: 6e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1770
TTGGAATCATAATACACCTTTGCGAAAGAACCAATCGAGTGGCACGCCTT
TAACAGAATCTTGCGGTACGGTACGGTACTCGAGTAGAATCCTCCTGTAA
ATCATCTCTAGGGAAAGCCGCAGTTGCCTTCACCGAAATGCTACCGGCGG
AAGCTCTCGCTAAGCCAGACCTTTGCGATGACGACTGTGTACCGCATTAT
GTGAAGCACCACTCAACATCACATCTAGCGTTCTCGTCGCTCCTGTTCAC
CGCTACCTTCTGCATTATTTTCCTAGGCGTCCTACAGCGGCTTTTTCCGG
TACTATGCGGGGCAGGCAGGCGCCACGCTCACCACGAGAATAGGGGGCAA
CGAAGGATCGCAGCGATAACCTTCTCGACCATCTTTGGAGCGACGGGGGT
ACTAGCAGAGTTGATACTATGCGAGGTGAGCGAGTGGGGAGAGGCTTCGG
CTCGGAAAGCTGGCTTTCAGAGTTGCGTGTGGGTCCTGATGATTTGTTTG
GTTGCGGTCGCGCCGTTACTTGAATTTCACAGCTTGGTTGAGGGATCAAG
GATATCTACCTGGCGAAGGCGATATGTTGTTCTGTTCGAGATGGCTATTT
TCGGTGTATGGCTTTGGGTCTTCT

Sequences in the Contig:

SY0AAA61YG24FM1 SY0AAD24YF01FM1 SY0AAD40YL05FM1