Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig177
Length(NT) : 634
Best Gene Model Blast : Link to GSTUMT00008426001 E-value : 2e-89
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_10006
Accession: ref|XP_001589371.1| Score: 219 E_value: 2e-16
KEGG Definition: C-3 sterol dehydrogenase/3-beta-hydroxysteroid dehydrogenase and related dehydrogenases
Accession: aor:AO090005000751 Score: 211 E_value: 9e-16
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig177
TTGGGGGGACAACTTTGTACAAAAAAGTTGGAAAAAGACCAGAAGGCTGA
AAGGAACCGCAAACCAAAAACCTACGATAGACACAGTCGCAATGACAGAA
GTGACGGCACCAGCACCAACGGGCACAGATACGAAGCCCAGTGTTCTAAT
CATAGGAGGCCTAGGTTCCTCTCCCCCCTCCTTCCCCTAGATACACGCAT
ACTCTACCCCCTCCTACCAATCATTGCTAGTCAATCGGATTACTAAAGCT
TCCTTATTTATTTATTTATTTTACGAGTGTGAATAGGCTTCATAGGACGT
TTTCTAGCGAAATACATTCACACAAACAACCTCGCATCCGAAATTCGAAT
AGTGGATAAGCAATTACCGCAGCTAGCGTGGCTTGCGCCGGAATTTACTG
ATGTTTGCACGTTGGAGAGGTTTCAACAGGGTGATCTCTCACGAGAACGT
ATGCATCCCTCTCCCTCCTCCCCAATGCATACCAAACTTTTTGCTCCTCT
CCCCTATACACCACCGCTATCCCCGCTAGTTCAAACTGGGCTGTAGCGGG
GCATGCGGTGAGGGAAAGAATAGAGAGAAGAAACGAGTGATAAGAGCTAA
ATAACTCTGGACTTGGAAAATTTAAAGATACATG

Sequences in the Contig:

SY0AAA16YH11FM1 SY0AAB40YL15FM1