Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1769
Length(NT) : 1395
Best Gene Model Blast : Link to GSTUMT00002795001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SS1G_04620
Accession: ref|XP_001594812.1| Score: 686 E_value: 5e-70
KEGG Definition: integral peroxisomal membrane protein
Accession: afm:AFUA_7G04160 Score: 638 E_value: 1e-64
KOG Definition: No Hit Found
PFAM Definition: Pex24p, Integral peroxisomal membrane peroxin. Peroxisomes play diverse roles in the cell, compartmentalising many activities related to lipid metabolism and functioning in the decomposition of toxic hydrogen peroxide. Sequence similarity was identified between two hypothetical proteins and the peroxin integral membrane protein Pex24p..
Pfam Number: pfam06398 Score: 326 E_value: 6e-31
Swissprot: Q06169|PEX30_YEAST
Gene Ontology:
GO:0005779 = Cellular component: integral to peroxisomal membrane
GO:0042802 = Molecular function: identical protein binding
GO:0007031 = Biological process: peroxisome organization and biogenesis

Sequence:
>Contig1769
TTGGCCCTAACGTCTCTCCAACCTATCACCACCACTCTGTCCCCCCTATT
CTGCTCTACCAAGTTTTCTAGTGATAACTTTTATCGTTAACTCGCTGGAA
AACTTGACCTCATCTCCAGCAGTCAATCAGGGTTAGCCCGATCGAATCCT
CAAATCACGGGCTGAGACGCTCGCTGACGACAGCTAGTTCAAACGGGGAT
GCATGGCAGCTCTCGATACTCCTTGGACTTTCTACATGTCTGATGAACCG
TCAAGCGGGGCCGAGCCCCTGACAGATCTCCACCCAACGCCGTCAACTAG
GGATCCTAATCCTCCAACTTTCGCTTCGTTCGCCCCACCGTCGAGTTCCC
CCGCTGCACGATCTACCTTTCAAGTCCACCAGAAGAGCCCTTTGCTCGCT
GCTACGCCGCCTCGGGTTACCCGCGCGCTGAGTCGGGCGTTTCCATACCT
TTCTGGATTGAATTGGGTTGCTGGTCTGCTCACCTGGACGACGAAGGACC
CTTGGGAGAGCTTCCTGGTTGTGGCGGCATTCTGGGCCGCGGTTTTATAC
GGTGACGTAGGGTTGCGCTGGGGCGGGAATGTTGTTGTGGTGGCGCTCTT
GATCTTGGGGATGTTTTTGAGGAGGTACCGGGATGAACCGACGCCGACTA
CACTGGATGAGATACTCGAGACACTGTCTACATTGACTACTCGGCTGAAC
ATCTTTTTCGAACCCTTCTTGTCGTTGACGAGATTTCTGTCCACAACAGT
TACTGCGACCACGGCTACGACCCGGCCTGTGCTTACCACGCTGTTCTTCA
GGATACTGATAACTACACCGATATGGTTGTTTTTCACGATTTATCCATTT
CAAGTGATAACCACCCGACGCGTAGTCCTCGCTACGGGGACATTGATACT
CTCGTGGCATTCCCGGCCGGCAAAGGTTAGCCGCACAATATTGTGGCGAA
GCTCACTGATCCGTGCGGTATGTTCGTATGTTACGGGACTTACTCTAGTC
CCCCTCCCACCGCCACCTGCACTGCCCCCGAGAAGGGCCCGGAAATCCAG
CATGAATAATCACACTGTAAACCCAGCTACTGCGTCGTCAACTTCAGTCA
ATTCGTCAAAAGCATCTCCACCCAAGAGGGCCCCGTCATTACAAATTGAC
CCGTCAAAAAGCACACCATTGACTGCTTCGACCACCGGCGCTTCTCCGGG
GGTTAAGTTCACGTTTGCAATTTACGAGAACCAAAGGCGTTGGTTGGGCG
TGGGCTGGACTAGTAGTTTATTCGCGTACGAGCGCGCACCTTTCACAGAC
GAGCACCTGCAGCCATGTCCGCAACCCGAGGAGTTTGCACTCCCGGAGAC
ACCGGCTGGAAGCGGTGTTCGCTGGCGCTGGGTCGAGGGGGAGGA

Sequences in the Contig:

SY0AAA22YB24FM1 SY0AAA46YM03FM1 SY0AAA61YG21FM1
SY0AAA7YA12FM1 SY0AAD24YC16FM1