Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1768
Length(NT) : 2325
Best Gene Model Blast : Link to GSTUMT00007776001 E-value : 0.0
Numbers of ESTs : 24

Blast Results:

Nr Definition: hypothetical protein NCU01066
Accession: ref|XP_961678.1| Score: 1460 E_value: 1e-159
KEGG Definition: L-AMINO ACID OXIDASE PRECURSOR (LAO)
Accession: ncr:NCU01066.1 Score: 1460 E_value: 1e-160
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0029 Score: 233 E_value: 6e-20
PFAM Definition: Amino_oxidase, Flavin containing amine oxidoreductase. This family consists of various amine oxidases, including maze polyamine oxidase (PAO) and various flavin containing monoamine oxidases (MAO). The aligned region includes the flavin binding site of these enzymes. The family also contains phytoene dehydrogenases and related enzymes. In vertebrates MAO plays an important role regulating the intracellular levels of amines via there oxidation; these include various neurotransmitters, neurotoxins and trace amines. In lower eukaryotes such as aspergillus and in bacteria the main role of amine oxidases is to provide a source of ammonium. PAOs in plants, bacteria and protozoa oxidase spermidine and spermine to an aminobutyral, diaminopropane and hydrogen peroxide and are involved in the catabolism of polyamines. Other members of this family include tryptophan 2-monooxygenase, putrescine oxidase, corticosteroid binding proteins and antibacterial glycoproteins..
Pfam Number: pfam01593 Score: 397 E_value: 7e-39
Swissprot: P23623|OXLA_NEUCR
Gene Ontology:
GO:0001716 = Molecular function: L-amino-acid oxidase activity

Sequence:
>Contig1768
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAAAGGACTCTCACGGTCCA
CGCTCTGTCCTGTCCTATCCCCAGTTGGCCACGGCCCACACAATACGAGG
GGACTCATTCCCTGGAATAAAATGACCAAATACACCTTTCTCTCGATTCT
GCTGACCGCAGCTACTTCAATTATCGCTTCACCCGCCCCTCATCCACTTC
ACTTAGAAGTCCGCACAGCAATCGATACGGGAGCCGCCAATGTCCACCTA
ATCCGTAGATCTCTTGTGAGCGAAGGGGTTGTATACACATACGGATCCTG
TGCTTCTTTTTCCTCCCAGGACTCTCACCACTTTGTCTCGAGCACGCCCC
TTGGTGTTGTTGCTGATCGGTTGCTGTGGAGAGTTCCTGAGGATGCCCCT
CCTGGTGGTTGTATTTCAGCATGGGGGATGAATGGCGGGAGCTTGCTCGG
ACGGAGCCTTCCGTTGGACGTACGGCCAGGGCTTAAGAAGAGGAACCTTG
AAAGGAGGCAGGTTAATCCTGTTAAGATGGATAATAGTAGTGGGATTGAT
ACAAGTGGGCCATGGTTCGATGGGGTCAAGTTGTTGAAGGATAAGGAGGT
TCCGCCGATTGTTATTGAGGAGTTGAAGAAGAAGAAAATTGGTATCCTCG
GCGCTGGAATCTCGGGGCTTATGACTGGTTTACTATTGGATTCCCAAGGG
TTTCATAATTGGGAGATTACAGAGGCATCCCAGAGACTTGGAGGCCGTAT
ACACACTGAGTACTTTGCCGGAGGTCCAACTACTGATGATTATCAATACC
AAGAGATGGGGCCGATGCGATTCCCTCGCTCGATCAAATATGCCGGAACG
AATGAAACCCTAATCATCCGTGACCACCACATCGTTTTCCAATTGGCAGA
ATACCTCAACAACATGAACAAAGGTGATGCGAACCTCGTTGTAAAATTCA
TTACTTGGATTCAGACAAACCCGAATACTCGTTCCTACTTCCAGGGCATC
AGGAAGCCAGATGGATCTGTGCCTACTTTGGCAGAAACACAAGCCGATCC
TTCACTCAACCCTGCCCCCATAACTGACCCTAGTTTTAAGGAAGTTGAGG
ACCAATTGTTCAACTTGTACATGACGAAGGAAAAGATGGCCGAGTTAGCG
AACAATGTTTATAGGGCTCATAAGAAGGCTATTGATGAAGGGTGGGACGA
TTTTTCAGAATTCGAGTATATTCATACTCTCCTTGGAGCATCGCTTAATA
TCACAGACTTGGCCATTCCCTTCCCAGAATCTTTTGCCGATTCATTCTGG
GGTGATTATATGGATAACGTTTACTTCTCTGCTACTGACTGGGTTACCAT
TGATCATGGCCTTAATCGTCTTCCACTTGCATTCGAGCCCATTGTAAAGG
ATAGAGTCCATTTTGGTCGAAGGGTTGATAAGATCAGCTATTCGAAATCA
GGGAACAAGGTCAAATTCTCTTGGAGAAAGGATTTCCGTGATAGAGACTA
CCTGAATGCGGAATATGATTACGCTTTGGTCGCAGCTCCGTTTTCAATTG
TTAGGAAATTGAGAACTCCAGCGTTCAGCAGTGTCCTCGGAAGAGCTATC
GGCAGATTGGGCTACACCAACGCTTGTAAGATAGCAGTGCAGTTCAAGAC
TCGATTCTGGGAACACCTGGACCCACCAATCTTTGGTGGTTGTACGACCA
CCGATATCCCGCTCATCCAAAGATACTGCTATCCATCGTACAACCTGAAC
GGTACTGGCCCGGGAGTGCTTCTCGCTTCGTACAACTTCGGGGGTGACGC
AGACCGGTCTGTCAGCTTCACAGACGATGAGCACATCGAGCACGTGATGG
CCGCTATGGAGGAGATTCATGGCCCTGTTGTAAGGCAGCAGTTTATGAGG
GCTGAACGCAAATGCTGGCTTCTTGATGGGCTTGAAGCGGGCTCGTGGGC
TGAGCCACTTATTGGGCAGCATAAGTTGTATATCCCTTCGTATTTCAATG
TAGAGAATAACATCATTTTTATTGGGGAACATACCTCGTATACCCATGCT
TGGATTGCTTCAGCACTAGAGTCTGCCGTTCGAGGAACAGTCCAATTGCT
CTTGGAGTGGGGTCTCGTCGACGAGGCGAAGAATATTACGGAGGCGTGGA
TGGGGAGATGGATCACGGTCTAAAACCCGGAAAGTGTTTTTGACAATGAT
GTTAATGGGAGCGTGCGTTGTGCGCTGTTGGGGTGGGTTATGAACCGTCT
TTTTTTGGTATTCTCATAATTTATCACTTGCCGGGAGTACGGTGTTTAGC
AAATAATCAAAGAGTTGGATAAGTT

Sequences in the Contig:

SY0AAA19YK23RM1 SY0AAA21YJ24FM1 SY0AAA27YG02FM1
SY0AAA31YN18RM1 SY0AAA39YC10FM1 SY0AAA46YD18FM1
SY0AAA52YI06FM1 SY0AAA55YC20FM1 SY0AAA5YF08FM1
SY0AAA61YG18FM1 SY0AAA62YE16FM1 SY0AAA7YF03FM1
SY0AAB12YL05FM1 SY0AAB13YL20FM1 SY0AAB16YG13FM1
SY0AAB17YK09FM1 SY0AAB18YH01FM1 SY0AAB19YD18FM1
SY0AAB23YO16FM1 SY0AAB33YA18FM1 SY0AAB35YI17FM1
SY0AAB37YJ07FM1 SY0AAB61YL09FM1 SY0AAB8YI10FM1