Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1767
Length(NT) : 1238
Best Gene Model Blast : Link to GSTUMT00009813001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein BC1G_10007
Accession: ref|XP_001551267.1| Score: 1200 E_value: 1e-129
KEGG Definition: hypothetical protein
Accession: ang:An12g00490 Score: 1159 E_value: 1e-125
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0415 Score: 1154 E_value: 1e-127
PFAM Definition: Pro_isomerase, Cyclophilin type peptidyl-prolyl cis-trans isomerase/CLD. The peptidyl-prolyl cis-trans isomerases, also known as cyclophilins, share this domain of about 109 amino acids. Cyclophilins have been found in all organisms studied so far and catalyse peptidyl-prolyl isomerisation during which the peptide bond preceding proline (the peptidyl-prolyl bond) is stabilised in the cis conformation. Mammalian cyclophilin A (CypA) is a major cellular target for the immunosuppressive drug cyclosporin A (CsA). Other roles for cyclophilins may include chaperone and cell signalling function..
Pfam Number: pfam00160 Score: 255 E_value: 1e-22
Swissprot: Q2U256|PPIL4_ASPOR

Sequence:
>Contig1767
TTGGCCTCGTCAACCTCCATTCACTCTTCAGACCCTCTCACCTGGGCTGG
CAACCCTTGATCACAGTATACCAACATTAGCCTACATACTTGTGCCCTCC
GCTCCCTGTTAAGCCATTCAATTATGCATCGCGTCCTCGCCTAATCATCT
TTCTCTAGCTGCACACCCCCTACCATCCTCCCACTTCATATTCGACAACC
AAGCAGTTGCGACATACTCTGATATAATCGCCTACCTCATTCATCCTCTT
CCTCTCTTTTCTATGGCCACTGAGCTTCCGCTACTATGTCTGTGCTACTA
GAGCTCGGGGAGACAGGTGACATTGTCATTGATCTCCTTGTCGACCTTGC
CCCCAAAGCGTGCGAGAACTTCCTCAAGCTATGCAAAATAAAATATTATA
ATTTTTCCCCCGTTTATAGTGTTCAGAAGGATTTCTCTTTTCAAACCGGT
GACCCCATTGGGCCTGACTCTCCTGAGTCAAGTGGGGGTTCATCGATCTG
GGGCCTTCTGGAGGGTCCTTCCAAGCGCCTATTTCCCGCGGAGTTTCATC
CAAAACTGAAGCACACGGAACGTGGTACTGTGAGCATGGCTACCGCCCCT
GGTAGAAATCCAGATGAGCGCGTGGGTGGAAGTCAGTTTATCATCACTAC
AGGTGACGAGTTGGATTACCTGGATGGAAAGGCTGCGATATTTGGTAAAG
TTGTTGAAGGCTTTGATACTCTAGAAAAGATCAACAATGCCTTCTGTGAT
GGCAAAGGAAGGCCACTAAAGGATATCCGAATACATCACACGATTATTTT
AGAAGATCCATTTGATGACCCTGATGGTTTTAGAGAGCCATCCCAGAGCC
CTGTCCCGTCAAATGCTCAATTAGCGACCGTGAGAATTGGGGAGGATGAA
GAAATCAAGGAGGATGATGATCCCGAAGCAGTCGAGAAATCAAGGCGAGA
ACGAGAAGCAAGGGCACAAGCGTTGACATTGGAGATGGTTGGCGATCTTC
CCTTTGCGGATGTCAAGCCACCAGAAAACATTCTCTTCGTTTGCAAATTG
AATCCCGTTACTCAAGACGAGGATCTTCATTTGATTTTCAGTCGTTTTGG
GACCATCCTGTCGTGCGAAGTGATTAGAGACAAGAGAACCGACGATAGCC
TCCAGTATGCTTTTATTGAGTTTGAGGACCAAAAGGCTTGCGAGCAGGCC
TACTTTAAAATGCAAGGAGTATTGATAGATGACCATAG

Sequences in the Contig:

SY0AAA14YB23FM1 SY0AAA61YG12FM1 SY0AAB13YE03FM1
SY0AAC51YM16FM1 SY0AAD50YF20FM1 SY0AAD62YO04FM1