Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1766
Length(NT) : 1452
Best Gene Model Blast : Link to GSTUMT00004178001 E-value : 1e-86
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG4590 Score: 114 E_value: 2e-06
PFAM Definition: No Hit Found

Sequence:
>Contig1766
TTGGCATCAAACAAGACCTTTCAAGAAGAAGAAAAACATCACGAGCTTCT
AAGGAACAAGCACAGACAAAACACGAGCTTTCGCCACTACCCTATACTAG
CATCCTAGTCGAATTCGCAAACACTACCCCCTAAAGAACTAGCTTCTCTA
TCCTTATTCTATTTGCCGCTACGGTCCAAAAGTTTAAAGCTACCGACGAA
CCTACCCTCTTCACGATGCCTGCACCAAACAATCCGCCGCCACCACCAGC
TCCGCAACCACCACGGCTCCCAACTCCTGATATCGGGGCTGCACCTCGGG
GCATGTTCGGGAGAATGCACCGATGAATGAGCGCGCTACAAAGGATCTGA
AGAACAATCCCTCCTCTTAATTCAAAATTATATAAAAAAGGAACCTGCTT
CGAGCGAGATTATCACCCTCCTCAATGCCTCGACATTGCGCTGGTCATCG
TCACCCCCCTCGAAGCACACTCCATCGGACGAAAATGGACGGAATGCCTT
CCTTCCCTCCCTAGGGGAAGCGACCCATCTCAACCTTTTCGAATCCGATA
CTCCGTACCGGACGAATGTCTTGTTTGATTTTGTTTGATTTTTCTTCTTC
TTTCGGTCACCTTCCTTCCTTCCTATCTCTCTATTCCATTCATCAGACAT
GACCCATTTTCCAATCGCCATTGTTCATCGGGAATCTATCGATCTGGTCG
GGACGAACGGGTACCGACGAGCAAGGAAGGAAGGAAGCGACGGGCGGACG
TCACAAAAGAAAAAGAGAACAAAAACCAACGGAGCATTTCATCCTACAAC
TCGCGACTTTTTCCTTTTTTTTTCCTCCCTTCTACTTTCATTCGTCTTTG
ATTTTTCTAGTTACCTCCGTCCGTGATTTCGAGACGAAAGAGCTTCTATT
ATTTCCCCCTCTTTCAAAAGGGCGGTCACGTGACGTGAGTCAGAAAACAA
CGAATGGGTTTGGGGGAAGAAGGGGAAACAACTGCTGAGGAATCCTTTCT
CTCTCTTTCTATTGAATTCCATTCCTTCCTCTTCTATTTTTTTTCTCTTA
TTTCCTTTCCTATTCCATCCTTCTTTCTTCTTCCTCCTTGTTTTTTCTTT
CTTTTTTTTCCGTTGGGGGTAGCGATGGGGCGGAGGAGGGGGAGTTGTGG
TATCTGCTGGATACTTTTGACGAATTGTTTCTCCGTATTTTCTTTTATTA
TGATTTTTCTTTGCTTTTCGTTGACTCCTTTGATCGCTATGACTGTTTTT
CCGTTCGCCTTGCGCTGTGGGGCGCCCGAGGGAGGGGGGTGGTGGGAGAG
GAGTCGTATGCGATGATGGTTGTGATGGTGGTGGGGGTTCTGTATTTGGA
GGAGGACGAGGGCGGGCGTTGGAGGGGGTAAAGGTACGTGAGATGGCTAT
TTTGGGAAGTGGGAAGTCGCCAGGGTTAGGGTTTTTTTTTTTTTTTTTTT
TT

Sequences in the Contig:

SY0AAA22YP18FM1 SY0AAA33YA13FM1 SY0AAA56YO18FM1
SY0AAA61YG10FM1 SY0AAD34YC24FM1 SY0AAD44YG02FM1