Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1765
Length(NT) : 2158
Best Gene Model Blast : Link to GSTUMT00003361001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: ubiquitin C-terminal hydrolase (HAUSP), putative
Accession: ref|XP_001266209.1| Score: 2028 E_value: 0.0
KEGG Definition: ubiquitin C-terminal hydrolase (HAUSP), putative [EC:3.1.2.15]; K01072 ubiquitin thiolesterase
Accession: afm:AFUA_5G03250 Score: 2023 E_value: 0.0
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1863 Score: 1296 E_value: 1e-143
PFAM Definition: UCH, Ubiquitin carboxyl-terminal hydrolase..
Pfam Number: pfam00443 Score: 605 E_value: 5e-63
Swissprot: Q9UTT1|UBP21_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0045859 = Biological process: regulation of protein kinase activity

Sequence:
>Contig1765
TTGGCAAAAACCAAGGTGCTACATGCTACCTGAATTCTCTATTGCAATCG
TTATACTTCACCAATAGCTTTCGGAAGGCTGTCTACCAGATCCCTACCGA
GAACGAACCGCTCTCAAATAGCGCACTCACTCTGCAGCGCTTATTTTATC
TCCTCCAGACGTCCAATGAAGCAGTTGGGACCTACGAGCTCACACGATCC
TTTGGATGGGAGACACAGGATATATTCGCCCAACAAGATGTCCAGGAACT
CAATCGCATTTTAATGGAGAGCTTGGAACAGAAGATGAAAGGAACCGAGG
CAGAAAATTCTCTGACAAAATTGTTTGTAGGGAAGACGAAAACCTATATC
AAGTGCATCAATGTGGACTACACGTCCGAGAGGATTGAGGACTTTTGGGA
TATCCAACTCAACGTACGAGGCTTCAAAAACTTGGATGAGTCTTTCAAGG
ATTATATTGCGGTTGAGACGATGGATGGGGAGAATAAATACTTTGCTGAA
GGCCATGGACTCCAAGACGCAAAGAAAGGAGTGATATTCGAATCTTTCCC
AGAAGTTCTACATCTCCATCTAAAACGTTTCGAATACGATTTGAACACGT
ATGCGATGCAGAAGGTGAACGACCATTACGAGTTTCCCCAGGAGTTTGAT
GCGGCTCCGTATCTCTCCGAAGATGCCGATAAGTCGGAGCCTTATTCTTA
TGCCCTACATGGTGTTTTGGTACATAGCGGTGATCTCAATGCGGGCCATT
ATTACGCTTTTCTGAAACCTGAGAAGGATGGCAAGTTCTTGAAATTTGAT
GATGATCGTGTGACGAAGGCAACCCTGAGGGAGACAATGGATGAGAACTT
TGGAGGTGACTATGGGCCAGCTACTAATGGGCTTCCGAGAAACCCACAAG
CCCGGGCCATTTCTATAAAAAGGTCCATGAATGCCTATATGTTGGTTTAT
CTCCGAAAAAATAAGATCGACGAGATCTTACCCACAGTGAGCGAAGAGGA
CACGCCTGCGCATCTACAGAAGAAACTGGATGAGGAAAGAGCAACTCGTG
AATTACGCAAGAGAGAAAGGGATGAGCAACACTTATACCTCAACGTGAAG
GTTATTACAGAGAGTCAGTTCAAAGCCCACCAAGGTTTCGACCTTACCTC
CTGGGATGACAAAGATCAACCTGAGGAGGCGCAGCCAAGGCACTACCGGG
TCCTCAAAGCTTCTCTGGTTAAAGACCTTGTTGAAAAGGTAGCCGCAGAT
ATTCGTGTTGATCCCGGTAATGTGAGATTATGGATAATGGTCAATCGCCA
AAATAAGACTGTTCGTCCGGACCAGCCCATCACTATGCCAGAAATGAGTA
TTGAGGACGCCTCAAATAAGCATAACAACAAGTCGAGCGACTTTAGACTA
TGGGCGGAGGTTGCAACTGAGACTAAACCAGGCAAAAACCTTGAGCCCTG
GGCTCAGGCTCGAGACTCAAACAGTGCTTGGATAGTTGTATTTCTCAAAC
GCTATGACCCCGAGTCACAGACACTGCGCGGGGTTGGCCATTTATACATG
CGGAAAAACGACAAAGTTGCAGAGTTAATACCGGCGATTCTGACCGAAAT
GAACTGGCCGCAAAACACACTCCTAAGGCTTTACGAGGAAATAAAACCAC
AAATGATTGAGCCCATGAAGCCGAAGCAAACTTTCAACCAGGCTGAGATT
CAGGATGGCGATATCATATGTTTTCAGAGAGCCTACACCGAAAAAGAGGC
ACTAGCACTTTTTCAGAAGAATCTGATCCCTGATGCCAAAGACTTTTACG
ATCTTTTGGTCAACAGGATTGTCATCAAGTTTCACCCAAAGAGTCCTCAT
GTCGCAGAGGGGAAAGTGTTCGATCTGACACTTAACAAGAAAATGACATA
TGACCAACTCGCAGAAAAAGTTGGTGAATATCTTGATGCGCCACCTACGC
ATCTAAGATTTACCACCATCAATGCTGCTACTGGAGGCCCTCGGTCGATA
ATCAAGCGAAGCCCCAATACAACACTCCATCAGATGCTTACAACTACCTA
TTACAGCAATACGACCATCTCACCAAATAGTCTATGCTATGAAGTTTTGG
AGCTATCACTCACCGAGCTCGAGACGATGAAAACTCTCAAGCTATACTGG
CTACCTGA

Sequences in the Contig:

SY0AAA22YP01FM1 SY0AAA61YF16FM1 SY0AAB15YI22FM1
SY0AAC25YN06FM1 SY0AAC28YH17FM1 SY0AAC33YL24FM1
SY0AAC48YM16FM1 SY0AAC55YD19FM2 SY0AAC8YI06FM1
SY0AAD17YG04FM1 SY0AAD38YP03FM1 SY0AAD52YH08FM1