Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1764
Length(NT) : 994
Best Gene Model Blast : Link to GSTUMT00011943001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_04805
Accession: ref|XP_001594997.1| Score: 551 E_value: 2e-54
KEGG Definition: 14-alpha sterol demethylase Cyp51B [EC:1.14.13.70]; K05917 cytochrome P450, family 51, subfamily A (sterol 14-demethylase)
Accession: afm:AFUA_7G03740 Score: 539 E_value: 2e-53
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG0684 Score: 424 E_value: 2e-42
PFAM Definition: p450, Cytochrome P450. Cytochrome P450s are haem-thiolate proteins involved in the oxidative degradation of various compounds. They are particularly well known for their role in the degradation of environmental toxins and mutagens. They can be divided into 4 classes, according to the method by which electrons from NAD(P)H are delivered to the catalytic site. Sequence conservation is relatively low within the family - there are only 3 absolutely conserved residues - but their general topography and structural fold are highly conserved. The conserved core is composed of a coil termed the meander, a four-helix bundle, helices J and K, and two sets of beta-sheets. These constitute the haem-binding loop (with an absolutely conserved cysteine that serves as the 5th ligand for the haem iron), the proton-transfer groove and the absolutely conserved EXXR motif in helix K. While prokaryotic P450s are soluble proteins, most eukaryotic P450s are associated with microsomal membranes. their general enzymatic function is to catalyse regiospecific and stereospecific oxidation of non-activated hydrocarbons at physiological temperatures..
Pfam Number: pfam00067 Score: 131 E_value: 2e-08
Swissprot: P49602|CP51_USTMA
Gene Ontology:
GO:0008398 = Molecular function: sterol 14-demethylase activity

Sequence:
>Contig1764
TTGGCAAAGTCCCAAAGGACTGGGGCTCCGTGCAAGCAGACGATCAAGTT
GGGCAAAGGTTGTCTTGCGCCAAGAATCCTGGCGGGAGTGCTGAAACTCC
CCTTTCTGGCCTGAACGCCTCTGAGCCTCTGAGCCCCATGACAATCTTCT
TATCCCCTTTTCTTGGGATCTCTAATACCGGTATTACCTTCTTTCTATTC
TTTCTTTCTTTTTTTCCCCTTCCCTCCCCTTCTCGCCTCACCCTCTCTAC
TTTTCCTTCATTCCCTTATCTACCCCCTTCCCCCTCCGTCCATTCAATTC
CCAACGGTTCAACTTCACTCTTTCGTCGTGTTAATTCTTTGTTGCTTTTT
TCAAACTTCAACGTCTGTTTGAACGAACCCCTTGCTCTATCCAACGTTTG
ATACAACAGCAGCAACCAGAATGGGTGTCTTGTCAACTTTGTTGGTCCCC
ATGGGACCTTACTATGAAGAGCTTATGAGGCTTGGTGGACCTGCATTGTG
TGGAATTGGGTTCATTGCTTTTGTTGTGCTGTCCGTCATTATCAATGTCC
TCCAACAGCTACTTTTTGTGGACCCTACGAAGCCTCCAATGGTCTTCCAT
TACTTTCCATTTTTCGGTAGCACGGTGATGTACGGAATGGATCCTTACAA
GTTCTTTTCTGGGTGCCGGGAGAAGTACGGGGATGTCTTTACTTTTGTCA
TGCTGGGAAGGAAAATGACGGCGACATTGGGTCCTAAGGGGAACGATTTT
GTGTTTAACGGAAAGCTTTCGGAGGTTAGCGCAGAGGATGCCTATGCACA
TTTGACGGTTCCTGTCTTCGGTGAGGGTGTTGTTTACGATGTTCCAAACC
ATGTCCTCATGGAACAGAAGAAGTTCATGAAATTCGGTCTCACCACTGAG
AACTTCCGTTCATATGTCCCCCTTATCGTCGAGCAGGTTGAGGATTATAT
TAAGAAGTCCAAGTTCTTCAAGGGGGCAAAGGGTTCTGTTCCTC

Sequences in the Contig:

SY0AAA32YP03FM1 SY0AAA61YF15FM1 SY0AAB25YE14FM1
SY0AAC27YP20FM1 SY0AAC34YN24FM1 SY0AAD55YL23FM1