Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1763
Length(NT) : 965
Best Gene Model Blast : Link to GSTUMT00004492001 E-value : 0.0
Numbers of ESTs : 24

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001274862.1| Score: 344 E_value: 1e-30
KEGG Definition: integral membrane protein
Accession: afm:AFUA_3G13650 Score: 309 E_value: 8e-27
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q01738|CDH_PHACH
Gene Ontology:
GO:0047735 = Molecular function: cellobiose dehydrogenase (acceptor) activity

Sequence:
>Contig1763
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTTTCTTTTCCCATAGATA
TATATATGAAGCGGTGTCCCTTCTCCCTGCCTTCCTTTCAGCTTCTTTGA
TCTTTTAGCTCTGTCTGTCCGTCCGTCTGTCCAGTTCGTTGAAAGTTTTT
TACTTGTGCTGAATACACAACGCCATCTATCGGACCATAACAGTAACGTA
ACACACACGACTGTACGCGAAGAAGAAGAACGGAGGTTAGGGAAATGGTT
TCTTTTAAAAGCTTTCTTGCTACGGCCGTGATCTCTGCTGCGACACTCAC
ATACGCGCAGAGCTCGTCGCCAGTGCAAGGCTTCACTGACCGGAGTTCGA
CCTTTGTCGCCAACTGGAACCTCCCTGCTTCTGGGGACGATGTCTTCTTG
CATATCCGGGGGCCTACGAGCGCAGGATGGATCGCGACGGGAATTGGCTC
GGCGATGAGCGGTTCCTTGATGTTTATTATTTACCAGAACGGGGAAGGGA
ATGTTACCTTTTCACCTAGACTTGGGACGGGTGAAGTCGAACCGAAATTC
GAATCGTCAATCCAGTTCGAACTGCTCGAGGGCACTGGGGTCCAGGGGGA
GTTAATGACCGCAAACATCAAATGCAGTAATTGCAGAACCTGGGACGGCG
GTAGCCTTGCCGTGACCTCGACAAACCAAAACTTCATTTGGGCCATCGGT
GACCAGACGGTCACCTCAAAATCCCAAACCGAAACCCTCAGCAAGCACGT
CCGTAATGGCTTTTATCGCCTCGACATGACACAGGTCACTGGCGGCGACT
CACCGAACCCGTTTGTGAGCGGCGACTCGGCCAGCGGTACCGCGTCCGGA
GGAGCAGAAGCGACTGGGAGTTCGAGTTCGAGTGGTTCGAGTTCGGGTCG
TGGTGCGAGTGCGAGTGCGACTGGGGGTTCGGGTGGAAGTAGTACTAGCT
TTTCGCCGCCGATGA

Sequences in the Contig:

SY0AAA10YF10FM1 SY0AAA13YB20FM1 SY0AAA20YI09FM1
SY0AAA2YN03FM1 SY0AAA30YC13FM1 SY0AAA30YF20FM1
SY0AAA32YB24FM1 SY0AAA48YH20FM1 SY0AAA56YC19FM1
SY0AAA58YA02FM1 SY0AAA61YF11FM1 SY0AAA61YK20FM1
SY0AAA9YE20FM1 SY0AAB19YL08FM1 SY0AAB19YP19FM1
SY0AAB37YL22FM1 SY0AAB37YO15FM1 SY0AAB39YD06FM1
SY0AAB41YH13FM1 SY0AAB43YD08FM1 SY0AAB50YO07FM1
SY0AAB58YH15FM1 SY0AAB59YJ15FM1 SY0AAB5YO01FM1