Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1762
Length(NT) : 685
Best Gene Model Blast : Link to GSTUMT00007856001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein An18g01910
Accession: ref|XP_001398650.1| Score: 253 E_value: 3e-20
KEGG Definition: hypothetical protein
Accession: ang:An18g01910 Score: 253 E_value: 1e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig1762
TTGGCTAACGGTAAACTTTTCCCCAACAAACGAGAGCAACAAAACTCGTA
CGCTTGACAAAATGAGCCGAACATTATTAAATTTTCAAAACTCAAGCGTG
ATCGGCAACAACCACAACAGTGGGAATATCGTAAACAGTTACAACTCTAT
ATCCATATCTGGAGACAAAGGCCAGGTTCTGGAGTGGCTATCACCATGGA
CATCACGGGAAAGGCACGGGACTGTTCGTAACGAGCGGGCGGGTGGAGTC
GGAAACTGGCTGCTTCGCGAGGAAAGCTTTTCTACATGGCATACATTGGA
GAATGCGAAGCCTGTGCTATTATGTCACGGAGATCCGGGCGTCGGTAAGA
CGTATATCAGCTCGCTTGTAATAGATACACTTTCCAAAGGAACTTATCGA
GAGACTGTGGCCATCACTTATGTCTACTGCGACTTCACAGCTCGCGAGGT
TCAATCTGTTCGCAATCTCTTGGGATCGGTGTTAAGGCAGGTTATATCAG
CAATGACAGAGACCCCCAGTGAAGTACTGGCTGCGTTTGAGCGTGCGAGA
AAATACGCCGATGGTTGTAGGCTCCAACTTTCCGAGATCCTCACGCTGCT
CATCGGGTATCTATCGAATTTGAAACGGAACTTCATATGCATCGACGCTC
TAGACGAGCTTCCACAAAAGGAGCGGCCCGAGCTT

Sequences in the Contig:

SY0AAA54YL01FM1 SY0AAA61YE09FM1 SY0AAC37YH22FM1