Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1761
Length(NT) : 979
Best Gene Model Blast : Link to GSTUMT00002304001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1761
TGTACAAAAAGTTGGGTCTTCAGTTCTTTTGTCGAGGATAATAAAGGTTC
TACTTTTTACCTTCTTGGTTCATTGTTTTTATTTGCTTTTGCATTTATTT
GGTAAAAGGCTCGGGAGCTTGACACTACCACCACTGCTACTTCTATTACC
ACTACTACTTCGTACAACAAGCATCCTACTACCACCGCATAACCACAGAA
CCGCAATCAAAATGCTCGCAATCCAGTTCCCCTCGTCGCCCATAGACGCA
AGAACACCCAGCCCACCTACCTCTTTCCACGCGGACTACTACACATCAGC
GCCCCTCCTCGCACCACCTCCAGTCAACAAGCGCCGGGCCGGGCCTCCAA
AGCTTTCACTCCAGATCACCAGCGAGACCCGTAGAACCTTCTCCAAGTCC
TCCATCCCACCGGTCTCTGCCGGCCCACTGTCGCCGACTTCGCTCTCCAC
CCAGCGCAACACGCAATTCAACGCGCGCCGTGACTCCGCTCCGACAAGTT
TCTCCGCTGCTCCGATCGAACAGGCCTCTTCGCGGACGAATGGCAGCAAC
AAGAAGAGGAGAATGGGCGCGCGAACGGTCGGGTTCGCCGAAGGCGTCGA
GGTGATTGGGTATTCCGTACGATGGGAAGACAAGCAGCCGCAGCGGGTTG
AGGAGGAGAGTTCCTCGAGTAGCAGCAGTGAGGACGATGAGGAGGAGGTT
AGGGCGCGAAAGGTTGGAGGGAACTTGAGAGGGTTGGAGCAGATGGAGGC
GTTGAAGCTCGGACGAGGCTCATCGAGGGGATATAATTGGAGGATGAAGA
TGTTGAACTCCAGGTCTTCCATTCCCACCACTACAGATGAGGTTACAGAG
CCTATGTCTGCGACTCTGGGTACAAGTACCGGCGGGGTAGGGTTTGGATT
TGGGAGTGGGATCGGGAGGTTTTCGTGATTATATTGTGACGGGGATTTGA
GATTTTCGTTCCTTCATCCTTCTTCCATG

Sequences in the Contig:

SY0AAA61YD02FM1 SY0AAB19YK16FM1 SY0AAB54YC23FM1
SY0AAD25YG13FM1 SY0AAD60YI17FM1