Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1760
Length(NT) : 1043
Best Gene Model Blast : Link to GSTUMT00000105001 E-value : 1e-177
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CIMG_01163
Accession: ref|XP_001247392.1| Score: 645 E_value: 2e-65
KEGG Definition: hypothetical protein
Accession: mgr:MGG_02505 Score: 582 E_value: 2e-58
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2785 Score: 485 E_value: 2e-49
PFAM Definition: No Hit Found
Swissprot: O59811|YJVF_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig1760
TTGGACCAGGGATATCGTATCCGTCACAATCGCTGTGGAATCTAGAAACC
TGGAATAGTCACACTCTCCATCTGCAGCTCCGCGAGCAAACCCCTGCATT
TACCCCCTCCCCAGCGGAATATTTACCCCTCGTCTCCCCACCACTTCTGG
AAAACGTTCATAAAACGCTCACATCTCAAAGAATAAAAAAAAAAAAAGTT
GTCATGACGTCCGTTCTACCGGCTACGGCTCCAAGCATGCAGAGTGCTCC
TATATCGCAGACGCACCCTTACACCTGTAATGCATGCCAGGTCGCTTTTC
GCAATCATGACCAGCAGCGCACTCATTATCACACCGACTGGCACCAGTAC
AATTTGAAGCGGAAGGTTGCTTCTCTTCCCCCGCTCTCCTCCGAAACGTT
CGCCGAAAAGGTCCTCACAGCTCAGGCTTCCACAAGACTGGAACGGGAGC
GTGCTTCTTTCGAGAGAACCTGTAAGGCATGTAATAGGACGTACTATTCT
GAAAACGCTTACGTGAACCACGTGGGATCCCAGCGGCATCGGCAGAACGT
CACAAACTTGGACTTGAGCGCTCTCCGCGCAGGTGGGGGCAACGGGGGGT
CCCGAGTCAGCGAGAAGGACGAAACCGGTAGTGTTATTAGTAGCACATTT
TCGCTTGGGGAGCCAGTTGAGATGTCGCAGAATAAGGAGCAGGAAAAGGT
GGTTTCTGACACAGAGTTCGCGGGTATGGTGCAGGCCTTGAAGGTTGCCG
AGGCGGTTGGAAATGAGTCCTCTGGATCTTGGACTAATACCGTCACCTCG
CTCTCAAGTGGCGATGTGCCTAAGGCTGCTACTGCAGAAAAATTAGAGGA
TTTACCACAGTTGCCGATTGAAGCGTGCTTATTTTGCACATACGTGTCTC
CATCACTACTGCTTAATGTATCGCACATGACTAAGGCGCATGGCCTATTT
ATTCCTGAGCGAAATTTCCTTGCTGACCTGGAAGGTTTGATCCGGTATCT
TGGTCAAAAACTCGTCCTCGGGAATCAGTGCCTATACTGTAAT

Sequences in the Contig:

SY0AAA24YL02FM2 SY0AAA61YB22FM1 SY0AAC49YM04FM1
SY0AAC55YN19FM2