Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig176
Length(NT) : 921
Best Gene Model Blast : Link to GSTUMT00012085001 E-value : 0.0
Numbers of ESTs : 22

Blast Results:

Nr Definition: GTP-binding protein SARA
Accession: ref|XP_001591874.1| Score: 939 E_value: 1e-99
KEGG Definition: GTP-binding protein SAR1; K07977 Arf/Sar family, other
Accession: mgr:MGG_06362 Score: 922 E_value: 6e-98
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0077 Score: 808 E_value: 5e-87
PFAM Definition: Arf, ADP-ribosylation factor family. Pfam combines a number of different Prosite families together.
Pfam Number: pfam00025 Score: 628 E_value: 4e-66
Swissprot: Q5EMZ6|SAR1_MAGGR
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>Contig176
TTGGACACTATCTACCCGCTTACCTCGTCTACCTCAACACTCGACCTTTT
CTTTCTCCTGCTAATTTTTACTACCCCTCGAGAACTCCATTCTTTAAAAC
ATGTGGATGATAAATTGGTTCTGGGATGTTCTCGCCAGTCTAGGACTCAT
GAACAAGCATGCGAAGCTTCTATTCCTAGGTCTTGATAATGCTGGAAAGA
CTACGCTTCTTCATATGCTTAAGAATGATCGTGTGGCTATTCTGCAGCCT
ACTTTGCATCCCACCTCGGAGGAGTTGGCCATTGGCAACGTCAAGTTCAC
AACCTTTGATCTTGGTGGGCATCAGCAAGCTCGCCGTCTTTGGAAGGATT
ACTTCCCGGAGGTATCTGGAATAGTCTTCCTGGTCGATGCTAAAGACCAT
GAGCGTCTCGCCGAATCTAAGGCCGAACTTGACGCTCTTCTCTCGATGGA
GGACCTATCCAAGGTTCCGTTCCTCATTCTCGGAAACAAGATTGATCATC
CCGAGGCTATTTCCGAGGACGAGTTGAGACACCAACTCGGACTATATCAG
ACCACTGGCAAGGGAAAGATCCCGTTGGACGGAATTAGGCCTATTGAGGT
CTTCATGTGCTCGGTTGTTAAGAGGCAAGGTTACGGAGAAGGGTTCAGAT
GGATGTCCCAGTATGTCTAAATCAGCACAATAGCGCCGGTTGCCGGCGGT
CTTGAGGGGAAGGAGTAGATTGAAGACAGATAGGAATGAAGGGCAAAAAT
CAAAACTTTCTTTTCCAATTTTTTTCTTTTTCCTTCCCCCAAGAAATGGG
GACGCGGTCGTCTGCCATTTCCTATATTCAGCGCGAGGCAAGCCAGCACT
ATACGACAGGCAATGAAATTATTTGTTTCTTTCCTCCATACGGCTCGGGA
TATATATATACGTGAAGGGAA

Sequences in the Contig:

SY0AAA16YH08FM1 SY0AAA16YK03FM1 SY0AAA32YJ04FM1
SY0AAA37YB15FM1 SY0AAA43YI11FM1 SY0AAA45YL01FM1
SY0AAA50YI14FM1 SY0AAB12YB02FM1 SY0AAB20YE22FM1
SY0AAB27YK12FM1 SY0AAB37YI04FM1 SY0AAB40YE15FM1
SY0AAB46YO01FM1 SY0AAB5YL16FM1 SY0AAB61YG14FM1
SY0AAB9YA01FM1 SY0AAC26YF03FM1 SY0AAC62YA17FM1
SY0AAD18YA17FM1 SY0AAD25YG18FM1 SY0AAD30YB16FM1
SY0AAD43YM08FM1