Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1759
Length(NT) : 1665
Best Gene Model Blast : Link to GSTUMT00001719001 E-value : 0.0
Numbers of ESTs : 27

Blast Results:

Nr Definition: hypothetical protein BC1G_07808
Accession: ref|XP_001553721.1| Score: 491 E_value: 3e-47
KEGG Definition: nucleic acid-binding protein
Accession: afm:AFUA_8G05260 Score: 426 E_value: 5e-40
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0110 Score: 228 E_value: 2e-19
PFAM Definition: RRM_1, RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain). The RRM motif is probably diagnostic of an RNA binding protein. RRMs are found in a variety of RNA binding proteins, including various hnRNP proteins, proteins implicated in regulation of alternative splicing, and protein components of snRNPs. The motif also appears in a few single stranded DNA binding proteins. The RRM structure consists of four strands and two helices arranged in an alpha/beta sandwich, with a third helix present during RNA binding in some cases The C-terminal beta strand (4th strand) and final helix are hard to align and have been omitted in the SEED alignment The LA proteins have a N terminus rrm which is included in the seed. There is a second region towards the C terminus that has some features of a rrm but does not appear to have the important structural core of a rrm. The LA proteins are one of the main autoantigens in Systemic lupus erythematosus (SLE), an autoimmune disease..
Pfam Number: pfam00076 Score: 208 E_value: 4e-17
Swissprot: P41891|GAR2_SCHPO
Gene Ontology:
GO:0005730 = Cellular component: nucleolus
GO:0003723 = Molecular function: RNA binding
GO:0007000 = Biological process: nucleolus organization and biogenesis
GO:0006364 = Biological process: rRNA processing

Sequence:
>Contig1759
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAAAACCAGTAGCAACTCT
TCCACCAAATCCTCCACTCACTCATCTTCTCTCTACCCCTCAATTATTAT
CTTCTTTTTCCCATTTCTCTTCGATATCTTCATCACTCTTGTCCGAATTA
CCTACAATTGAAAATGTTTTCTATCAGCCGTGCTGCTTTGCGGTCTTCGC
GCCAGTCTGCCATTGCTCGTCCATTGGCTTCTGCATTCTCCCCGGGCACA
TTTGTTAACACAAGATCGCGCCCATCCAACTTGTCCGAACTCCGTTCGTT
TGAGTCTCTTCTTCAACGCTACAATACCAACTATGGCTCTGGATATGGAA
GGGAGAGCCAAGGGGGAGGATACGGTAACCAAGGAGGATACGGTAATCAA
GGAGGAGGGTATGGTGGCAATCAAGGAAATGCTCCTAGGAACAATAATCG
CGGTTATAATAACAACAGTGCTGGCCGGACGGGTTTTGGGGATCGGAAAC
TGACCCCCACTAAAGTCGTCTATATTGGAAATCTTCAGTTCGATGTTAAG
GAAGAAGCTCTCCGGGATGAATTCAAGACCTTTGGCCCGATTCTGAGCGT
TAAGATTATCTACGATGCTAGAAACATGAGTAAAGGTTTCGGATACGTTG
AATTCGAGACCGTTGAACAAGCCACATCGGCCATTGAAAACGCCCATAAT
GCTGTCCTCATGGGACGCAGAATGAACGTCCAATATGTCCATCGTCCCAC
CACCGGGGCTAACGGTTTTAACGAGCCGTCAAAGACATTGTTTATTGGAA
ACTTGAGCTTCGATATGACCGATGCCGACTTTGACAGACTTTTCTCTGAT
ATCCCTGGTTGTGTTGATGTCCGAATTGCCATGGATCGCGCTACCGGGCA
ACCCCGTGGCTTCGCTCACGCTGACTTTGTTGACATTGATTCGGCGGTCC
AGGCCAAGGAGAAGTTGGCTGGTGTTGAGGTGTTTGGTCGCCGTCTCCGC
ATCGACTTCTCAGACCAGAGGAACTCTGGCCGCAGGAATGCCGTCCCTGA
GAATTACACCTATGGGAATGCCGTCCCTGAGAATAACGCCTATGGGAATG
CCGTCCCTGAGAATAACGCCTATGGGAATGCCGTCCCTGAGAATACCGCC
TATGGGAATGCCGTCCCTGAGGATGCCGGCTTTGAGGATCCTATGGCGTC
TCCTTCACCCCCTACACAAGAGGAGACCTTCGAGGAACGTTCAGACGACT
CAGAGGGAGGTGCACCTAAGCCTGATGGCTCCTATTAAATCAAGAGTAAA
AAAGGCGTGAAGGTTCAAAAGGGGGGTCCATCGAGGGAACGAAATTACGA
GTCTTTCATTATTGATCAATCAACGTAATGAACTGGGCTGTGGGATTTGA
AAGTGAGGGTGAGAGAGATCAAAAAGCTTGGTTAAAATGAGGGGAAATTC
AAACAAAATGTAAATTTATCGGGTCATGTGTTCTATCCAGGCTCTTCGTT
GCTCTTCGCTTTTTACCTTTTTTATAAGCAGTGGGGTGATTGTCCTTTTG
TCTTCATGTTTAAAAGTTCTCTTTCTCACTTTCAATTTTCACTTCCGATT
TTCGATTTCATTTCCCTTTTTGCTCCTTCGTTTTGTTAGCTTTTTTTTTT
TTTTTTGTCTGTATT

Sequences in the Contig:

SY0AAA24YA14FM1 SY0AAA24YA14FM2 SY0AAA27YI14FM1
SY0AAA33YL21FM1 SY0AAA33YL22FM1 SY0AAA34YE07FM1
SY0AAA49YO04FM1 SY0AAA52YJ02FM1 SY0AAA61YB18FM1
SY0AAB25YH13FM1 SY0AAB2YE19FM1 SY0AAB45YC23FM1
SY0AAC11YH18FM1 SY0AAC28YG14RM1 SY0AAC2YC17FM1
SY0AAC37YI21FM1 SY0AAC44YJ15FM1 SY0AAC50YL11FM1
SY0AAC54YA18FM1 SY0AAD14YH14FM1 SY0AAD31YA22FM1
SY0AAD31YK15FM1 SY0AAD32YM08FM1 SY0AAD3YA10FM1
SY0AAD3YK20FM1 SY0AAD58YH07FM1 SY0AAD6YL19FM1