Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1758
Length(NT) : 3428
Best Gene Model Blast : Link to GSTUMT00007115001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1758
TTGGCCGCCACTCTATCAATTTCATCTACTTTATCATCGTATATTATATC
GAGAAAGTGCGGCGTGAGAATTAATCCTAACCTAGTCATCGATTTTGGGG
GGGAGGAGGGGAGAGAGAAAAAGGGCTCTTCTATCCATCCGCTCACAGCT
AAGCTAAGGCACTGTTCCGGTACTAGCACTTATAGCATCCGTACAAGTAT
CATAGGTTGTACGTGTATGTGTCATGAAAAGTGCTCAGCCTCAATAACCC
GGTTCAAAAGTGCACTTTTTCACTCTTTTTTTTTTGTTGCTTTTTTCCCT
TTTCCTTTTTTTCCCAAGCAAAGACCTTGTTGTGGATAAATAAGCTTGAA
CTTGCTGTCTGTAGAGGCGAAGTACTCGAGTAGAGGCTTTCGCAGGGCTG
AAGTAGTGAGTGAGAGGGAAAACATGACGAAGAATTGGGACAGCGTTAAG
GTTAAGCTTCATGAGTTATACATGGAGAAAAACCTCAAGCTCGATGATAT
GATTCGGATTATGAAGGAGTCTTATGATTTTGGTGCGAGCCCCCGTGGAT
ACAAGAAGAAATTCAAGCAGTGGGGATGGTTAAAAAATGCCCCGGGCGAA
GGCCTTCTAGACGAGCCGTCGCTAGTCCACCAGATGACAATTCGGGCCTA
GAAATACTCAGCGATGTCGCGGCAGGAAGCCAGCACTCGCCGAAAGAATT
TACAAATGCTGTCGATGGCGGGGGAAACTTTGAGCCGGCGCAAGCGACCG
ACGGACCGACCCCCGGATACCACAACAGGTACCCGCCGATAGACATAGCT
CCGCAAGTCCCCGCCCGGACAGACACCGCCCGCGGGAGGGAAACTCCTGT
AAATCCTTTCACCCAAGCTTTGCCGACGTCCCCGAAGCGGAGAGTCAGGG
AACATGGTAGGCCTTCTGCCCATCCTTACAGTCGACCACGACAAAACTCG
CAGTCGCAACCGGGACATCAACGTGGACCGGGTAGTCTCGAGAGTATATC
TGCCAGTCTCACGGGTATGGGGATCGATCCTATACCTACAGCGGCGACAA
CCCCTATAGTAATGCATACACCCCCACTGCAATCTCCGTCATACCCATAC
TATATGCCCTCTTCCTCCCCAACTCCGCAGCAAGCAGAGCAAACCAAGAT
TTCATCGATCCAGCTATCAACTTTCAAAGCCCAAGTAATCGACCCATCGC
TCGCCGAGTTCCCCACATATCGGCTCAACCCCCCGCGCCTAAAGACAGAC
TTTATAGATGAGATATCAAATAAAGTGCTGCAAACGGCCCAGAAGCACCA
TCAAAAGAATGACTTCTGTTCGGCCGCTGTGATACTTCAGTTAGGCCTCA
GCAAGATAACACTTATGACCGTTGACCCAAACGAGTTGTTTTCCCAGGAA
CCGAGCCACTTATCATTGGCCAGGGTGATGGGTGAGTTTGTGGAGAGCGT
GTCGTGGGAGAACGTGTACCTTTTTAGGAACGGCTTCATGCTCGCTCTAC
TACTAAGCACGAACTACGAGAAAATCGGGGAAATGCATTTGGCCATATAC
GTTCTCGAGCAGACGTTAAAAGCCGTGCTCATGTCCCGGGTTGGAATACT
AACCGCCGGCGAGGACGAGGAGGAAACGCTGGAAGGAATGTTTGAATTCG
CAGACGAGGACTGCAGCAGGGTACTCCGCTCCATAGTCCGAATTAGAGAG
CTAAAAGAGGGGGGCGACACATCAGAGCACAAGGCCATCATGGCCGGAAC
CTTCGGCATACTAGAGCGCTTTCTTGGAGATTGGGAAGGGGCGTTCGGAG
TCCTTGGCGTGCTAAACCTAGGAGAATTCCTCGACGGCCTGTTAAGCCTT
GCGAAGAGGCACAAGATGGAGACAGCAGCAGTAGGTCAACTCAAGCAGAT
ACTCTCCAAGGCCGAGAAAGTACTCGTGTCGGGCGGTGGTTCCATGAGTG
TCGCTGGGGACAGCGAGAACTTCCGTTGGATATCTGCACGGTACTTCTCC
AGGATCTCGAGGAAGCTGTCGGCTTTGTATGAGTTATCTGGGCAAGCCCT
GGCAGGGATTCACTTGCTCAAGCGGGCGACTCGGATAGTCGGGAGCAACC
ATGACGGGCGCCCGTCCAGGAAGGAAAAGCGGGAGATGTTTGAGGCAACG
GCAGCCCAGGCGCGACTGCAGGAGAACAGCGGCCTGTGGGACGCTGCAGA
TAAAGCATGGAAACAGCTTCGGGGCGTGCTGGGCGAACGGGAGGACTTTG
AGTTGACTTTGAAGGTCGACGTAGCTATCGCCGAACTCCTCGCCAGGAAC
GGACGACAGGGTGAGGTGCTAGTGTTCTTGGAACATAGGATCAACGAGTG
TTTGAAGTATAAGATGCTTGAGCAGCAGCTGCCTAGCACTCAGGCGGCGC
TTGATGACGCCGAGCCAATTTTTAAGGCCATCTTGTCCCTGGCAAAGTTA
AGGCTTTCCGGGACGGTAACCGTCGCTGTTCCCCCCCCGGCTCTACAGGC
GTATTTTAATTGGTTACTTGGTATCAGGGGATTGGATGGAAGCGAGAAAA
TCGCCATTGCGCATAGGACTCTAGAACTACTTACAGAATTACAGTCCAGT
CATCCGAACCTAGCCTGCGCAAGCTTAATTGTATATGACGATTTTCTCCC
GGGATTCATCGACCTCCGCGACGTTGCCGCCCCATCACTCCCACAAAATT
CCCCTCACCACACTGCCATCCTCCGCTTCTTGTCACTAATCTACAACACC
GCTGGCAAAGACGACCAGCCGAGGCCCACCATCTCCCACATTGTGACCGC
GTTGTCATTACTCTTCGAAACACACCTCTCCAGAACTCAGACAAGCACTG
AGATACTCCTCTACGTCCACAGCCTAACCTCCGTCCTCTGCAGCCCCTCC
AAGGGCCGTCTGTGCGAAGAGTGCAAAGTGGATGAATTCACCACAGCAGT
GGCACTAGCAGAGCACTACGAGCGCCAGGGCGCGGCTCAAGATGGCGCAC
GCGTAATAGCGAGGATCATCGATGAGGCAGAGTCCGAGTTCCTTATCCCG
GCAACAAAAGGATGGGTAGGCTTCAGCTGGCTGAAAGTCCTCATGCGCAT
CGCAAAGTTCTACATCCGTCAGGGGCAGTCCGTCGCCGCGGTGGATATCC
TCGAACGGGTGCACAGGGCCAGCATTGAGCTGGGTGATTGGGACCGCGGA
GATCTAACCAGGAAAGTGGAACAATATGGGGTTTTCGATGAAAGCCGGAG
GTTACTGATGGAGTTCGAGCCCGCCTCTGTGCTTTGTAGGTGTGTGTGAA
TATCCGGTTAATTATCTTCTCGCTTATTTTCTTCTTTCGTTATCCCGGTG
GTCCGGATGGAGTGTGACTTTGTATGATAGATAGTATGGGTGGTCCATGC
CGCGGTAGTGTAGAGATACTATTATGAT

Sequences in the Contig:

SY0AAA13YK16FM1 SY0AAA17YB10FM1 SY0AAA37YL12FM1
SY0AAA38YF04FM1 SY0AAA52YE03FM1 SY0AAA52YK23FM1
SY0AAA60YI19FM1 SY0AAA61YB09FM1 SY0AAB10YB07FM1
SY0AAB24YC02FM1 SY0AAB24YC07FM1 SY0AAB49YC15FM1
SY0AAB50YB15FM1 SY0AAB50YC04FM1 SY0AAB51YJ14FM1
SY0AAB57YI18FM1 SY0AAC52YJ06FM1 SY0AAC60YA03FM1