Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1757
Length(NT) : 1269
Best Gene Model Blast : Link to GSTUMT00005705001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein CIMG_02198
Accession: ref|XP_001248427.1| Score: 209 E_value: 1e-14
KEGG Definition: F-box domain protein
Accession: afm:AFUA_3G13460 Score: 151 E_value: 3e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1757
TTGGCCGATCTCGCTCCGTTTACTCGAGTACCCGTACGGTACTGTATGAA
TAAGGTAGCCTATCCAACTCCTCAGAGCCTACTTTTCGCACACATTCCCG
ACCTTCATCGACATCACCGTACACTAATTTAATCGGGCCATATCCGACAA
TCTCTTCTCTAATCTCTTCCACACTGATCCCCGCCCATCCGGTGACCTCC
GTCGCCCAGCCCTACCGTCCCCGCTCCCCACAATGTTCGGTTCATCACCA
GCCGACGCATTTGAGCAGAGGGCTCAAAAGATCCGTCGCGCTGTGGAGCG
GGCACGCACGCAGTTCTTGCAGAAAACTAGACCCCGAAGTGCCAATCGGA
CATCCGACGTCCTAACAGGGTCATACTTCGACTACCTTCCGGTCGAGCTC
ATAATCAACATCTGCTGCCAGACCGACTGGAGGGACGTCACCCGTCTCCG
CCTCGTCTCCCGAGCCTTCAAGGAGCTCGTTGACGCTAACGAGTCTACCA
TCGCTACCAGATGGATGGTCCCCGGATCATATTTGGCGCTGCTCTCGCAA
CTCTTCTACCCACCAAAATCTAGGACAGGAGACGGGGTGCGCCGGCCTAC
GATACAGTACTTTTGCGGACTAGAGAAGAGACATGCCACGTGCTCGACGT
TGGCTTATTATCTTTGCGATAAGGCGGTTGCGCCGATGTATAGGACTCAG
TTCACGATTAATTGGAAGGATAGGGAGGAGGCCAAGCTTAGGAAGGATCA
AGCAATTCGGACGGTGCAGAGGAAGTTGACGAAACAATTGTATTATCCCC
CCTCGAGGGAGCTGGGGTTTTTTCTCTCTTTGTTTTTTTTGTCATGTTTC
TAGGTCACTGTCTGATTGGTTCTGTTTTACGAAAGCTTATATGGTTGATA
TTTAGGTATTATGTAAGGGCGTTCCCATCCTCCGTGCGTTCTTAACTCGC
CCCGAGCCAAGTTTAGGGCTCTCTCGAGACTTGGGGGAGAGGCGGGGTAT
GATAGCAAGAGAAGCGTCATCCGACAAACTAACTCTTCTAGGTCCTCCAC
TTCCTAACCTACTCCCGCCTCCGCCTAGAAGCCAACAAAGCCGCAATAGC
CGCCGAGAACTCCGATGAGCCGCTAACCCCCAGCGACCTAAACAGCGCCT
ACTTGAGCATCCAATCAAGCATATTGGCCACCTTCGACAACCAAACCCTA
ATATCCACGCACCACGCCCTGCACTTCCTAGTAAACTCCATCCGCCTAAG
CATGTCGCCAGAGCCTCCA

Sequences in the Contig:

SY0AAA61YA08FM1 SY0AAC42YH10FM1 SY0AAD55YK22FM1
SY0AAD63YM15FM1