Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1756
Length(NT) : 1667
Best Gene Model Blast : Link to GSTUMT00007972001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein AN8415.2
Accession: ref|XP_681684.1| Score: 1193 E_value: 1e-135
KEGG Definition: hypothetical protein
Accession: ani:AN8415.2 Score: 1193 E_value: 1e-136
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG0140 Score: 353 E_value: 7e-34
PFAM Definition: Acyl-CoA_dh_1, Acyl-CoA dehydrogenase, C-terminal domain. C-terminal domain of Acyl-CoA dehydrogenase is an all-alpha, four helical up-and-down bundle..
Pfam Number: pfam00441 Score: 194 E_value: 2e-15
Swissprot: P45867|ACDA_BACSU

Sequence:
>Contig1756
TTGGCCTAGTTTATATCACGATTTTGCATGAAGAAAATTGCTTCCGGTGA
TGATTAATTCATGGCGGCGAGAAATACTGAGGAAGCAAAATGGGTTGTCA
GCACCTGCCATGTGCAAGTCCTCCTTAAACTCCTCGGTTGACTCGCTCGC
GGTTATGAAATACGAGTACAGTAGAGCCGCCTTTTCGTCCCCGCGTTCTC
TCCCACAGCCCTGGCCTTGGCTTTCTTCGAAAACAGCAAGTCCCCCTGAC
GATAGCAAACAAAACATACAAGCAAACAATCTTACCCTGTCAGTCACTTT
GGCCGCCGTCTTACCCTTCTCCGAGCCTCCTTACCCTAATGGTCTCCCAT
CTCCATACTACGCCCCCTTGCATCACCGCTGGCAAAAGGCTTGTTGCGCG
TTCATTAGCGAGAACCTCACCGCGAACGCCTTGGAATGGGAGCGGGAGGA
GTTGGTTCCCCCAGAGATCTTCAGCAAGTTTGCTGCAGCAAATTTCCTCC
TGCCGAGCCTTCCTGCTCCGCTGCTGATCGAGTGGGCTAAGCAGCTGGGT
TTGGACATACTCGCAAGAGGTCTAAAAGTGGAGGAGTTTGATTATCTGCA
CTTTTTAATTTACAGTGATGAGATGACGGGGAACGGGCTGTCTGGTCCTG
GTGCCTCGCTTACGACCGGGATAACATTCGGGGTTCCGCCGATATTAAAG
TTTGGGAGCAAGCAATTGCTGGAGAGATTTATCCCGGATTTGCTCATGGG
GCGGGCGCGAAGCTGCATTGTGATTACGGAACCGGGGACCGGGAGTGACG
TAGCCGGGATTGAGAGAACGGCTGTGAAGTCAGCGGATGAGAAGGAGTAC
ATCGTTAATGGATCAAAGAAATGGATCACGAACGGGATCTGGGCAGACTT
CGTTACAACAGCCGTGCTCACCGGCGGCCCATGGCCTTCAGGTCTCTCAT
TACTCCTCATCCCACTGAAGAACAACCTGTCCATCATCATCCGCAAGTTG
GTTATCATGGGCCTTGCTGCCTCCGGCACCACATACATAGAGTTCGATGA
CACCCATGTCCCAGTCGAAAATCTCATTGGCATAGAGGGCATGGGTATCC
GCTGCATAATGACAAACTTCAACCACGAACTCTTAACCACCGCCATCGGC
GTAACGAGGCAAGCGCGTGTCGCCGTAAGCACAGCATTGGAATACGTCCT
CAAACGCGAGGCATTTGGAAAGGCGCTTGTAGAGCAGCCGGTCGTTAGGC
ATCGACTCGCGAAGGTCGGAGCTATGGTTGAGAGCATGTGGGCGTGGGTT
GAATAGATCACGTATCAAATGACCCAGATGAAGAAAGAGGATGCAGACCG
GGAATTGGGAGGGCTGACGGGACTGGCGAAGGCGAGTTCTGGGAGGGTGC
TCGATGAGAGTGTTTGATGCGCAGTTTTGCTTTTTGGCGGGAATGGGTTG
ACGAAATCAGGACAGGGGGAGTTGATTGAACAGACGTCCCGGCTGCGAGA
CTTTCAGGCGGTAGTGAAGATGTTTTGTATGATCTTGCGATTAGGGAGTT
GGTCAAGAATTTTCGTAAGAAATCCGGGAGATGGGGAGGACGTCAAAGTT
GTAGATTTGGGTGTTTACATGTACTTTTATAATGTGTAAATTAATGTATC
GATACCATGTGAGTTGG

Sequences in the Contig:

SY0AAA11YN24FM1 SY0AAA36YL03FM1 SY0AAA38YG05FM1
SY0AAA61YA03FM1 SY0AAB23YD19FM1 SY0AAB35YL16FM1
SY0AAB51YO04FM1 SY0AAC21YC10FM1 SY0AAC21YC10RM1
SY0AAC9YJ14FM1 SY0AAD24YF14FM1