Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1755
Length(NT) : 594
Best Gene Model Blast : Link to GSTUMT00004986001 E-value : 1e-138
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein An01g05920
Accession: ref|XP_001389016.1| Score: 452 E_value: 2e-43
KEGG Definition: hypothetical protein
Accession: ang:An01g05920 Score: 452 E_value: 9e-44
KOG Definition: No Hit Found
PFAM Definition: Methyltransf_12, Methyltransferase domain. Members of this family are SAM dependent methyltransferases..
Pfam Number: pfam08242 Score: 121 E_value: 1e-07

Sequence:
>Contig1755
TTGGCGGAAAACTGAGTAGAAGAAGCATGGACGAAAGAGCTGATTCTGGT
ATCTCTGGGGTGGTGTCCCCTCAGTCTCGCGCCGAAAACTATCTTGCGAC
CGAGGATGATACTTTCTCCGTTTCGTCGTCGATACTCGATTACGCCTATG
AGAATGGGAGGCGATACCATGCATTTCGACAAGGGGCATATTATGCGCCG
AATGATGAGAATCAAAACAATCAGCTAGATATCTTCCATCACATATACCT
CCTTCTCTTGGGCGGAGATCTCTATATAGCGCCGATAGAGCGACCAAAGG
TAAGTTTTACCCCCTAGTCTGTTATAGATGCTGAACCTTTCATGAAATAG
CGAATTCTGGACGTTGGGACCGGGACAGGAATTTGGGCAATGGACATAGC
CGACAAGTTCCCAGACGCAGAGGTTATCGGCACTGACCTTTCACCAATAC
AGCCCGAATGGGTTCCCCCAAACGTCCACTTTGAAATAGACGATGCAGAA
AGCCCTTGGACTTATCCCGAGAGTCATTTCGATTTCATCCACATCCGCTG
CCTTTTCGGTGCCATTGGTGACTGGCCCGCGCTGCTCGAACAGT

Sequences in the Contig:

SY0AAA40YN15FM1 SY0AAA60YP17FM1