Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1754
Length(NT) : 1214
Best Gene Model Blast : Link to GSTUMT00004053001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig1754
TTGGATCAACTATCAGCTTCCTCTCAGGAGAACATCGCTTCTTGTACTGT
ACTGTACGCGTGCTGTAACACCTTTTCTCTCACCCGATCAAGCCATTCAT
CTCTAGGCCACTTAACAGAAAAAGCAAAGGAGAAACATGTAAGTATCATG
GGCGGTTTTTTTCCTTCTCATTATCTCAGGCGCATTGCATCAAGCATCAG
GTATTGGGCGGGCGAAATAGCCAGATACGGAAATATCGAGCCAGTGCCCA
GTCTGAGTGGTATGCCTTCTTTTATTTGTTGCTAACACACACTTTTTCTA
CCACAGACCGCAAAACACATTCTACAAGTTTGCTCTGTTACCTTTCTCGG
ACCGCCGCATAACTTTGTTGTTCACTCAACCCCGCTTTTCTCTCGAGGAG
GTTTTTTAAAACCCCCTCATCCGTTACCAAAGAGCCTAGTTTTCCTTCGC
TCTAGAAACCCGCCACCAGCGAATCCTTTATTCTATCATTTTTGGAACTC
CCAAAAAAAGAAGTCTAGACATGGCAAGGTACACTACCGCAGACCCCTAC
ATGGGAGAAAGAGAACGACAATATCTTTCAGATCGTGCTCTTGATACTCA
GATGGCTGTATACTCACCTGATACACCTTTCAACAGTATTTCTACTATCA
CTCCATACACTTCCTACGGAAACCCGCATACTTCCACGGGTGGCCCTTGT
ACGCGGCGGTGTTATCGATGAGCCCGTTGTCGAACATGAACACCATCACG
TTCATCACCATATCGATCATGGTAAATATCTCCTTCTATCCATTCTTGGG
ATTTGAATCATCATGTTGATTTCGGCAGGCAATCCGGTAGCCGCTGCTCT
TGTCAGGCCCCGTGTTGCACGCGAGTATTCCTATGACGACCTTCACGACC
GTGAACGCAGATATGGTAGTGGTATGAGCTTGGGTAGTTTTGGCCACCAC
CATGGCCACCACTATGGGCACCGTCATCGTGGGCTCCTTGGGGGCCGGTT
TGCCCGATCAGATATCGATCTCAACCTGGATGCATCATATAGGCATCGGC
GAAGAAGCATCTATGATGATAGAGATTCGGAACTTGCAATTATTGATGTT
CCTGCTGGAACCCGTCGAGTGACTGTCGACATGGGTCGGGAGGTTGATAT
CAACTGGAGGCGGGATAACGGCGTTCGGAGATCAAGGGGATTGGGGAGTG
AGCTCTGGACCGAG

Sequences in the Contig:

SY0AAA22YA21FM1 SY0AAA60YO23FM1 SY0AAB22YF08FM1