Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig1753
Length(NT) : 979
Best Gene Model Blast : Link to GSTUMT00000470001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: COP9 constitutive photomorphogenic homolog subunit 4
Accession: ref|NP_001006447.1| Score: 600 E_value: 3e-60
KEGG Definition: COPS4; COP9 constitutive photomorphogenic homolog subunit 4 (Arabidopsis)
Accession: gga:422594 Score: 600 E_value: 2e-60
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones, Signal transduction mechanisms].
Kog Number: KOG1497 Score: 624 E_value: 1e-65
PFAM Definition: No Hit Found
Swissprot: Q3SZA0|CSN4_BOVIN

Sequence:
>Contig1753
TTGGACTCCGCACAACTTTCAAGAGCAGTCACCAAAAACCCACTCACAGC
CCATCCGGAAGGGTGAGAGGAAAAGAAAAGAAAAGAAAAAAGAACAGCCA
ACAATCATGGCATCCCCCGAGGTCCTCTCTCAGCTCACCTCTATCGAAAC
CTCTTCGGCCTCACAGGGCGACAAATCCCACTCCTTCATCGCCCTCCTCC
AGCCAATCCTCACAAACTCCCCAGCAGCCAGCCTGGAAGCCAACCTAAAA
GCCTTCGTGGACACGATCCTCAGCGACAACGTAGGCATAGTGACCAGCCG
CCCGGTGCTAAGCGAATACCTCCAAACGCTACCGTCCCTCGCCCCGGAGC
TGCAGAAATCCCTCTACACCTACACGCTGGACAAGATCTCGCCAAAGATC
GTCTCCTTTGAGCAAGCAGACTGCACAATCCGCCTGGCCCTTGCAACCCT
ACACGAAGCCTCGGAGGACAATGCGCAGGCGGCGCGGGTGCTTGAGGGCA
TCCAGCTAAACCCGCACCAGCGGCAGATCACGGACGAGTTCAGACTGGAA
GTGTACATCCGGATAATGCGCAACCTGCTGGAGGACGACGAGAGCATATC
CGCCGACAGCTGGCTCAACCGTGCCACCCTCATCATACACAAGAGCACGG
ATGCCAGCCTCAATCTGAACTTTGCCATGTGTCAGGCTCGCATACTCGAC
GCGAAGCGGCAGTTCCTGAACGCGTGCTCCAAGTACCACTTCCTCTCGTT
CTCGAACCTTGTCGCGGAGGCGGATAAGTTGCAGTGCCTGAGCGCTGCCA
TGACTTGCGCGATTTTGGCACCGGCCGGGCCCCTGCGTAGTAGGAGTTTG
GCAACGCTGTATAAGGACGAGCGCGCCCCGCAGTTGCACAGTGACTATGC
GCTCCTAGAGAAGATGTATCTCGATCGCTTACTCTCCGCCAAGGAGGTGG
AGGAGTTTGCAGCGCGCCTGCGCCCTCAT

Sequences in the Contig:

SY0AAA60YO15FM1 SY0AAB37YD18FM1 SY0AAC23YB19FM1